Informácie

Koncentrácia DNA izopropanolom

Koncentrácia DNA izopropanolom


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Čítal som, že DNA môže byť koncentrovaná pridaním izopropanolu.

Čo znamená „koncentrovaný“? Čo robí izopropanol na molekulárnej úrovni pri koncentrácii DNA?


To, na čo sa pýtate, je zrážanie DNA (alebo akejkoľvek inej nukleovej kyseliny) izopropanolom (alebo etanolom, čo je bežnejšie). Aby ste to dosiahli, pridajte soľ (zvyčajne mierne kyslý octan sodný), ktorý zaisťuje, že fosfátový hlavný reťazec DNA je nasýtený iónmi sodíka, aby bola menej rozpustná. Potom pridáte organické rozpúšťadlo, ktoré zmenou polarity roztoku vyzráža DNA z roztoku. To spôsobí, že ióny tvoria soli a DNA sa vyzráža. Princíp je vysvetlený v článku Wikipedia o zrážaní etanolom. Nakoniec sa roztok odstredí, aby sa zozbierala DNA na dne vašej reakčnej skúmavky a aby bolo možné odobrať supernatant.


Koncentrácia DNA izopropanolom - Biológia

Tento postup sa používa na extrakciu plazmidovej DNA zo suspenzií bakteriálnych buniek a je založený na postupe alkalickej lýzy, ktorý vyvinuli Birnboim a Doly (Nucleic Acids Research 7:1513, 1979). Procedúra využíva skutočnosť, že plazmidy sú relatívne malé superšpirálové molekuly DNA a bakteriálna chromozomálna DNA je oveľa väčšia a menej superzávitnicová. Tento rozdiel v topológii umožňuje selektívnu precipitáciu chromozomálnej DNA a bunkových proteínov z plazmidov a molekúl RNA. Bunky sa lýzujú v alkalických podmienkach, čím sa denaturujú nukleové kyseliny aj proteíny a keď sa roztok neutralizuje pridaním octanu draselného, ​​chromozomálna DNA a proteíny sa vyzrážajú, pretože je nemožné, aby sa správne renaturovali (sú také veľké). Plazmidy sa správne renaturujú a zostávajú v roztoku, čím sa účinne oddeľujú od chromozomálnej DNA a proteínov. V pohode, nie?

Poznámka: Nižšie uvedený postup sa používa na vytvorenie duplicitných minipríprav. To poskytuje vyvážené skúmavky pre centrifúgu, ako aj dvojnásobné množstvo produktu, keď skončíte.

1. Jemne krúžte obsahom kultivačnej skúmavky, aby sa bunky resuspendovali.

2. Označte dve 1,5 ml skúmavky a do každej skúmavky napipetujte 1000 ul bunkovej suspenzie.

    Táto časť postupu zbiera bakteriálne bunky, ktoré sú suspendované v kvapalnom médiu, do bunkovej pelety na dne skúmavky.
    Bunky sú teraz resuspendované v pufrovanom roztoku s RNázou. Keď sú bunky lyzované v ďalšom kroku, RNáza bude katalyzovať hydrolýzu všetkých molekúl RNA na nukleotidy, ale DNA nebude ovplyvnená.
    SDS je skratka pre Sodium Dodecyl Sulfate. Je to iónový detergent, ktorý narúša bunkové membrány a destabilizuje všetky hydrofóbne interakcie, ktoré držia rôzne makromolekuly v ich natívnej konformácii. Vysoké pH 0,2 M NaOH tiež denaturuje makromolekuly zmenou stavu ionizovateľných skupín (Ionizácia určitých skupín a deionizácia iných). Čistina, ktorú vidíte, je preto, že bunky lyzujú. Viskozita roztoku sa zvyšuje zvýšením koncentrácie makromolekúl v roztoku (výsledok bunkovej lýzy).
    Toto je skutočne kľúčový krok v postupe alkalickej lýzy. Nízke pH roztoku octanu draselného neutralizuje NaOH a keď sa pH vráti na takmer neutrálnu úroveň, makromolely sa renaturujú. Proteíny a veľké molekuly DNA sa však nerenaturujú správne. Tvoria medzi sebou hydrofóbne, iónové a vodíkové väzby nešpecificky, pretože počas denaturácie nebola zachovaná správna konformácia molekuly. Molekuly plazmidovej DNA však nikdy nie sú úplne denaturované, pretože sú to malé kruhové molekuly, ktoré sú superzvinuté. Aj keď boli vodíkové väzby medzi pármi báz prerušené vysokým pH, pri znížení pH sa správne reformujú. Veľké molekuly DNA (chromozomálna DNA) a proteíny tvoria precipitáty, pretože sa na seba viažu vo veľkom agregáte, ale plazmidy sa nezrážajú, pretože sa správne renaturujú a nestávajú sa súčasťou veľkých multimolekulových agregátov. Plazmidová DNA teda zostáva v roztoku, zatiaľ čo sa proteíny a iné molekuly DNA vyzrážajú.

10. Skúmavky vložte do centrifúgy (vyváženej) a odstreďte pri maximálnej rýchlosti 5 minút. Spojte sa s niekoľkými ďalšími ľuďmi na tejto rotácii. Zrazenina bude peletovať pozdĺž strany skúmavky.

11. Preneste supernatanty do čistých 1,5 ml skúmaviek, pričom dávajte pozor, aby ste nezobrali žiadnu zrazeninu. Skúmavky so zrazeninou zlikvidujte a Skúmavky UCHOVÁVAJTE so supernatantom.

    Táto koncentrácia izopropanolu spôsobí, že sa DNA stane nerozpustnou. Pretože molekuly DNA sú iónové (jednotný negatívny náboj spôsobený fosfátmi), sú vysoko rozpustné vo vode, ale nie sú rozpustné v organických rozpúšťadlách. Izopropanol a etanol sa bežne používajú na vyzrážanie DNA z vodného roztoku.

14. Pridajte 200 ul absolútneho etanolu do každej skúmavky a niekoľkokrát premiešajte prevrátením.

    Toto „premývanie etanolom“ urýchli proces, pretože ďalším krokom je odparenie alkoholu použitého v kroku zrážania. Absolútny etanol sa odparuje oveľa rýchlejšie ako roztok 50% izopropanolu.

17. Umiestnite skúmavky do digestora s otvorenými uzávermi na 15-20 minút, aby sa vysušili posledné stopy etanolu.


Izolácia genómovej DNA

Výťažok, čistota a integrita sú nevyhnutné pre výkon v následných aplikáciách, ako je PCR a sekvenovanie. Optimalizácia extrakčných metodológií je kľúčom k úspechu pri náročných typoch vzoriek a náročných následných aplikáciách. Purifikovaná cieľová DNA by nemala obsahovať kontaminanty, vrátane proteínov, iných bunkových zložiek a nežiaducich nukleových kyselín.

Pre zložitejšie a náročnejšie vzorky, ktoré obsahujú degradovanú DNA alebo majú nízke koncentrácie DNA, môžu byť potrebné špecializované purifikačné súpravy špecifické pre typ vzorky. Náročné typy vzoriek zahŕňajú FFPE tkanivo, plazmu alebo sérum obsahujúce bezbunkovú DNA, forenzné vzorky alebo akýkoľvek zdroj, kde je množstvo vzorky limitujúce.

Promega bola jednou z prvých spoločností, ktorá poskytla súpravy na čistenie DNA, ako aj plazmidov, s viac ako 30-ročnými skúsenosťami s extrakciou nukleových kyselín. Ponúkame širokú škálu súprav na extrakciu genómovej DNA, ktoré sú vhodné pre rôzne typy vzoriek a požiadavky na priepustnosť, produkujúce vysoké výťažky a vysokokvalitnú DNA na použitie vo vašich následných aplikáciách. Naše produkty pokrývajú rôzne možnosti priepustnosti a metódy spracovania vhodné pre vaše špecifické potreby – od manuálnych jednoduchých príprav až po malé stolové alebo veľké automatizované systémy.

Naše manuálne riešenia s jednou prípravou využívajúce metódy odstreďovania, vákua alebo magnetických metód sú najlepšie na spracovanie menej ako 24 vzoriek naraz. Ak hľadáte automatizované riešenie, naše kazetové súpravy na použitie s nástrojmi Maxwell® Instruments dokážu spracovať až 48 vzoriek v rovnakom cykle. Ponúkame tiež plne automatizované možnosti vysokovýkonnej extrakcie využívajúce metódy spracovania na báze dosiek, plne kompatibilné s platformami na manipuláciu s kvapalinami.

Hoci techniky ako Southern blotting, ktoré vyžadujú mikrogramové množstvá DNA, sa stále vykonávajú v laboratóriách molekulárnej biológie, väčšina hodnotení chromozomálnej DNA sa vykonáva technológiami založenými na PCR. Tieto zahŕňajú monoplexnú alebo multiplexnú PCR, polia SNP, analýzu a PCR v reálnom čase, ddPCR a sekvenovanie novej generácie (NGS). Tieto posledné techniky využívajú nanogramové množstvá DNA na reakciu. Bez ohľadu na zvolený systém poskytujú súpravy na purifikáciu genómovej DNA Promega požadované výťažky vysokokvalitnej DNA s minimálnym množstvom kontaminantov.

Manuálne čistiace systémy

Systémy založené na riešení

Promega ponúka systémy izolácie genómovej DNA založené na lýze vzorky pomocou detergentov a purifikácii rôznymi metódami. Patria sem oba membránové systémy (napr. jednostĺpcový Wizard® SV Genomic DNA Purification System (kat. č. A2360, A2361) alebo vysoko výkonný, 96-jamkový Wizard® SV 96 Genomic DNA Purification System (kat. č. A2370, A2371) a ľahko automatizované systémy paramagnetického oxidu kremičitého Všetky tieto systémy čistia genómovú DNA, ktorá je vhodná na použitie v mnohých nadväzujúcich aplikáciách.

Wizard® Genomic DNA Purification Kit (kat. č. A1120, A1125, A1620) je všestranný a škálovateľný systém na izoláciu genómovej DNA pomocou metódy založenej na precipitácii. Len pomocou tohto systému je možné izolovať chromozomálnu DNA z plnej krvi (5), listov rastliny (6), grampozitívnych (7) a gramnegatívnych baktérií (8), myšieho chvosta (9) a kvasiniek (10). Úspešne sa použili aj ďalšie typy vzoriek, ako sú huby (11), infikované tkanivá žaby vložené do parafínu (12), sliny (13) a chrobáky (14).

Tento systém genómovej purifikácie je nielen úspešný s mnohými typmi vzoriek, ale je tiež ľahko prispôsobený na množstvo východiskového materiálu úpravou objemov činidiel tak, aby vyhovovali vašim potrebám.

Systémy založené na stĺpcoch

Tradičné stĺpcové systémy

Pre izoláciu v jednom stĺpci poskytuje Wizard® SV Genomic DNA Purification System rýchlu a jednoduchú techniku ​​na prípravu purifikovanej a neporušenej DNA z myších chvostov, tkanív a kultivovaných buniek už za 20 minút, v závislosti od počtu spracovaných vzoriek. (do 24 odstredením v závislosti od veľkosti rotora alebo do 20 podtlakom). Na spracovanie vzoriek sa používa vákuové potrubie alebo mikrocentrifúga. S určitými úpravami je možné s týmto izolačným systémom použiť aj plnú krv (15). Ide o systém na báze kremičitej membrány, čo znamená, že existujú obmedzenia týkajúce sa množstva materiálu, ktorý je možné naložiť na jednu kolónu SV až do 20 mg tkaniva (myší chvost alebo zvieracie tkanivo) alebo medzi 1 × 10 4 a 5 × 10 6 bunky tkanivovej kultúry môžu byť spracované na purifikáciu. Pri väčšom množstve vzorky môže byť potrebné pripravený lyzát rozdeliť do dvoch alebo viacerých stĺpcov, aby sa zabránilo upchávaniu.

Obrázok 2. Amplifikácia genómovej DNA izolovanej z rôznych tkanivových zdrojov pomocou Wizard® SV Genomic DNA Purification System. Jeden mikroliter purifikovanej genómovej DNA sa amplifikoval pomocou PCR Master Mix (kat. č. M7502) a myších špecifických IL-1&beta primerov (1,2 kb produkt). Reakcie s myšou genómovou DNA (kat. č. G3091 +C) a bez DNA (&ndashC) boli uskutočnené ako pozitívne a negatívne kontroly, v danom poradí. Podmienky tepelného cyklovania boli: jeden cyklus 3 minúty pri teplote 95 °C, po ktorom nasledovalo 30 cyklov: 95 °C počas 30 sekúnd, 60 °C počas 1 minúty, 70 °C počas 1 minúty a 30 sekúnd konečné predĺženie pri teplote 70 °C počas 7 minút, namáčanie 4 °C. Všetky dráhy obsahovali 10 mikrometrov reakčného produktu oddeleného na 1 % agarózovom géli. Produkty PCR sa vizualizovali farbením etídiumbromidom. Označenia "Spin" a "Vacuum" označujú protokol použitý na izoláciu genómovej DNA.

Genomická DNA izolovaná pomocou Wizard® SV Genomic DNA Purification System má vysokú kvalitu a funguje dobre pri analýze agarózového gélu, štiepení reštrikčnými enzýmami a analýze PCR, ako je vidieť na obrázku 2. Tabuľka 1 poskytuje typické výťažky genómovej DNA purifikovanej z rôznych zdrojov.

Tabuľka 1. Typický výťažok genómovej DNA z rôznych tkanív pomocou systému na purifikáciu genómovej DNA Wizard® SV.

Ukážka Čiastka Priemerný výťažok
Strihanie chvosta 20 mg 20 ug
Pečeň 20 mg 15 ug
Srdce 20 mg 10 ug
Mozog 20 mg 6 ug
CHO bunky 1 × 10 6 5 ug
NIH/3T3 bunky 1 × 10 6 9 ug
293 buniek 1 × 10 6 8 ug

Výskumníci použili tento jednoduchý a rýchly systém pre mnoho ďalších typov vzoriek a aplikácií vrátane komárov (16), kmeňových buniek prsníka (17), Bacillus subtilis (18), Escherichia coli (19), larválna forma Schistosoma mansoni parazita (20) a vírusovej DNA z buniek BC3 infikovaných herpes vírusom Kaposiho sarkómu (21).

Pre vysokovýkonnú 96-jamkovú izoláciu je k dispozícii Wizard® SV 96 Genomic DNA Purification System. Amplifikovateľná genómová DNA môže byť izolovaná až z 5 x 106 buniek, 20 mg tkaniva alebo až 1,2 cm špičky myšieho chvosta bez centrifugácie lyzátu pred čistením.

Tento viacjamkový systém vyžaduje vákuové potrubie (Vac-Man® 96 Vacuum Manifold, kat. č. A2291) a vákuové čerpadlo schopné generovať 15&ndash20 palcov ortuti alebo ekvivalent. Genomická DNA sa izolovala z troch rôznych zdrojových typov, potom sa použila v monoplexnej PCR a spustila sa na agarózovom géli, ako je znázornené na obrázku 3. Obrázok 4 porovnáva výťažok z troch metód purifikácie genómovej DNA Wizard® SV (96-jamková platňa, vákuum a centrifugácia ).

Obrázok 3. Elektroforéza produktov PCR na agarózovom géli amplifikovaných z 1 mikrometra genómovej DNA zo vzorky myšího chvosta, CHO buniek a listov rajčiaka izolovanej pomocou Wizard® SV 96 Genomic DNA Purification System. Na 1,5 % agarózovom géli zafarbenom etídium bromidom sa vizualizuje celkovo 10 mikrogramov PCR produktu. Panel A. IL-1&beta (1,2 kb) amplifikovaný z myšieho chvosta. Panel B. &beta-aktín (250 bp) amplifikovaný z CHO buniek. Panel C. Chloroplastová DNA (600 bp) amplifikovaná z listu paradajky. Dráha M, 1 kb DNA Ladder (kat. č. G5711).

Obrázok 4. Porovnanie výťažkov DNA s použitím Wizard® SV a SV 96 Genomic DNA Purification Systems. Priemerný výťažok genómovej DNA v mikrogramoch purifikovaných z 20 mg odrezkov myších chvostov. Priemer A260/A280 pomery sú: SV 96, 1,7 & plus 0,08 SV vákuová metóda, 1,7 & plus 0,14 SV metóda odstreďovania, 1,7 & plus 0,14.

Vysokovýkonné stĺpcové systémy

Ponúkame dva rôzne systémy ReliaPrep&trade gDNA Miniprep System, ktoré purifikujú genómovú DNA pomocou metódy založenej na celulózovej kolóne: ReliaPrep&trade Blood gDNA Miniprep System (kat. č. A5081, A5082) a ReliaPrep&trade gDNA miniprep System (kat. č. A20521). Oba sú systémy pripravené na použitie, ktoré získavajú neporušenú genómovú DNA bez použitia etanolového premývania alebo zrážania. Systém ReliaPrep&trade Blood gDNA Miniprep System spracuje 200 μl krvi alebo telesnej tekutiny, či už čerstvej alebo mrazenej, za menej ako 40 minút. Výťažky z krvi sú zvyčajne 4&ndash10&mug, v závislosti od počtu bielych krviniek. Systémom ReliaPrep&trade gDNA Tissue Miniprep System možno spracovať až 25 mg tkaniva, bukálny (lícny) tampón alebo 1 cm myší chvost a eluovanú DNA získať za 30 minút alebo menej. Purifikovaná DNA môže byť eluovaná v množstve 50 mikrometrov a je vhodná na použitie v následných aplikáciách, ako je RT-qPCR.

Obrázok 5. Výťažok genómovej DNA zo systému ReliaPrep&trade Blood gDNA Miniprep System sa mení podľa počtu bielych krviniek. Od niekoľkých jedincov sa získala plná krv a pomocou hemocytometra sa stanovil počet bielych krviniek. Na purifikáciu genómovej DNA sa použilo dvesto mikrolitrov krvi (n = 3 alebo 4) a množstvo izolovanej gDNA sa kvantifikovalo absorbančnou spektroskopiou.

Obrázok 6. Porovnanie elučného objemu s koncentráciou, výťažkom a čistotou. Alikvóty krvi (200 ul) sa spracovali s použitím systému ReliaPrep™ Blood gDNA Miniprep System (n = 4) a eluovali sa 30 a 200 ul vody bez nukleázy. Koncentrácia (Panel A), celkový výnos (Panel B) a čistota (Panel C) boli hodnotené pomocou absorbančnej spektroskopie. Výťažok sa mierne znížil so znížením elučného objemu, zatiaľ čo koncentrácia sa zvýšila. Čistota meraná pomermi optickej hustoty zostala konštantná.

Automatizované systémy na čistenie DNA

Keď sa laboratóriá snažia zlepšiť produktivitu výskumu, diagnostiky a aplikovaného testovania, zvýšila sa potreba ľahko použiteľnej automatizácie procesov čistenia s nízkou až strednou priepustnosťou. Automatizácia eliminuje praktický čas a prácu pri ručnom čistení, čo vám dáva viac času a energie, aby ste sa mohli sústrediť na svoj výskum.

Systémy založené na kazetách

Tradične sa automatizácia týka používania veľkých, špecializovaných a nákladných zariadení, ktorých prevádzka a údržba si vyžaduje rozsiahle školenie. Spoločnosť Promega vyvinula systémy Maxwell®, ktoré poskytujú flexibilné, spoľahlivé, kompaktné a ľahko použiteľné alternatívy k tradičným automatizovaným systémom.

Systémy Maxwell® sú navrhnuté na efektívne, automatizované čistenie zo širokej škály typov vzoriek (pozri tabuľku 2). Prístroje Maxwell® sa dodávajú s predprogramovanými automatickými purifikačnými metódami a dokážu spracovať až 48 vzoriek už za 30–40 minút (v závislosti od prístroja, typu vzorky a metódy). Purifikovaná koncentrovaná DNA alebo RNA má vysokú kvalitu a vysoký výťažok, vďaka čomu sú kompatibilné s mnohými bežnými následnými aplikáciami, vrátane qPCR, ddPCR, genotypovania, sekvenovania a NGS.

Obrázok 7. Maxwell® RSC (vľavo) a Maxwell® RSC 48 (vpravo).

Tabuľka 2. Výťažok DNA z rôznych typov vzoriek po purifikácii pomocou Maxwell® RSC Instrument a DNA Purification Kits.

Až 50 mg pečeňového tkaniva
Až 50 mg pľúcneho tkaniva

Súpravy Maxwell® ponúkajú vopred pripravené kazety s činidlami na čistenie genómovej DNA, RNA a celkovej nukleovej kyseliny. Súpravy zamerané na aplikácie a vzorky robia z Maxwell® Instruments všestranný extrakčný nástroj pre laboratóriá, ktoré môžu pracovať s jednou alebo všetkými týmito rôznymi aplikáciami.

Obrázok 8. Metódy extrakcie DNA alebo RNA Maxwell® RSC začínajú kazetami vopred naplnenými čistiacimi činidlami a paramagnetickými časticami, ktoré sú pripravené pre vaše vzorky. Po pridaní vzorky Maxwell® RSC pohybuje paramagnetickými časticami a súvisiacimi nukleovými kyselinami prostredníctvom viacerých krokov, čím sa nakoniec získa vysoko čistá RNA alebo DNA v 30–100 µl.

Systémy Maxwell® Systems čistia vzorky pomocou paramagnetických častíc (PMP), ktoré poskytujú mobilnú tuhú fázu, ktorá optimalizuje zachytávanie vzorky, premývanie a elúciu nukleovej kyseliny. Prístroje Maxwell® sú nástroje na manipuláciu s magnetickými časticami, ktoré účinne viažu nukleové kyseliny na paramagnetickú časticu v prvej nádobke vopred naplnenej kazety. Pred eluovaním nukleovej kyseliny sa vzorky spracujú sériou premytí. Systematická metodológia založená na magnetických časticiach používaná prístrojmi Maxwell® Instruments sa vyhýba bežným problémom spojeným s automatickými systémami čistenia založenými na manipulácii s kvapalinami, ako sú upchaté hroty alebo čiastočné prenosy činidiel, čo môže viesť k suboptimálnemu spracovaniu čistenia.

Stolové kompaktné prístroje Maxwell® Instruments sa ľahko nastavujú a na používanie si nevyžadujú žiadne špeciálne školenie. Optimalizované automatizované metódy sú vopred vložené, predplnené reagenčné kazety sú zacvaknuté na miesto, vaša vzorka je pridaná a výberom "Štart" spustíte príslušnú metódu. Úplný zoznam súprav na extrakciu nukleových kyselín je k dispozícii tu.

K dispozícii je niekoľko reagenčných súprav Maxwell® Instrument, ktoré umožňujú optimálnu extrakciu z rôznych typov vzoriek vrátane krvi, séra a plazmy, tkaniva fixovaného vo formalíne, zaliateho v parafíne (FFPE), baktérií, rastlín, potravín a živočíšnych tkanív.

Systémy Maxwell® HT umožňujú purifikáciu DNA alebo RNA vo veľkom meradle na akomkoľvek laboratórnom zariadení na manipuláciu s kvapalinami v 24- alebo 96-jamkovom formáte SLAS. Čistiace chemikálie Maxwell® používajú nové roztoky na báze magnetických častíc, ktoré prirodzene znižujú prenos kontaminácie.

Okrem dôveryhodnej chémie získate odbornú podporu, aby ste mohli začať s automatizáciou alebo optimalizovať svoj súčasný pracovný tok HT. Náš tím odborníkov na automatizáciu môže ponúknuť pomoc s väčšinou popredných poskytovateľov laboratórnej automatizácie na svete a pomôcť vám vyvinúť a implementovať automatizované riešenie na čistenie nukleových kyselín prispôsobené potrebám vášho laboratória.

Súpravy na extrakciu genómovej DNA

Hľadáte možnosti extrakcie podľa stupnice alebo typu vzorky? Preskúmajte naše portfólio extrakcie DNA a objavte správne riešenie pre vaše potreby čistenia.

Škálovateľné automatizačné riešenia

Prístroje Maxwell® RSC poskytujú kompaktnú, automatizovanú platformu na čistenie nukleových kyselín, ktorá súčasne spracováva až 16 (Maxwell ® RSC) alebo až 48 (Maxwell ® RSC 48) vzoriek.

Vysokovýkonná čistiaca chémia a podpora automatizácie

Chemikálie Maxwell® HT umožňujú automatizáciu čistenia nukleových kyselín na manipulátoroch s kvapalinami. Náš tím odborníkov na automatizáciu ponúka pomoc pri vývoji a implementácii automatizovaného riešenia na čistenie nukleových kyselín prispôsobeného potrebám vášho laboratória.

Vysokovýkonné systémy na izoláciu genómovej DNA

Promega ponúka niekoľko automatizovaných vysokovýkonných možností na izoláciu izolácie genómovej DNA zo vzoriek krvi. Niektoré laboratóriá, ako napríklad biobanky, chcú izolovať DNA z veľkého množstva východiskového materiálu (napr. 10 ml krvi). Veľkoobjemový HT gDNA izolačný systém ReliaPrep &trade (kat. č. A2751) poskytuje účinný prostriedok na izoláciu genómovej DNA odvodenej z krvných frakcií odvodených z 2,5 až 10 ml vzoriek plnej krvi. Túto chémiu je možné automatizovať na manipulátory s kvapalinami pomocou zariadenia Promega HSM, ktoré umožňuje spracovanie purifikačných reakcií v 50 ml kónických skúmavkách.

Snímanie hladiny kvapalín a operačný softvér prístroja škálujú chémiu na vstupný objem vzorky pre každú jednotlivú vzorku, čím sa znižuje plytvanie činidlom a náklady. Automatizovaný systém dokáže spracovať aj vzorku v 14ml skúmavkách pomocou nízkoobjemového adaptéra XAT1020 (LVA and Methods), ktorý umožňuje spracovanie vzoriek od 0,25&ndash3ml.

Neexistujú žiadne zdĺhavé kroky odstreďovania alebo nebezpečné chemikálie, ktoré sú neodmysliteľnou súčasťou pracovnej stanice a ponúkajú purifikáciu genómovej DNA z plnej krvi bez ohľadu na podmienky skladovania vzorky alebo prepravy.

Obrázok 9. DNA bola izolovaná z plnej krvi tromi metódami, separovaná CHEF gélovou elektroforézou a vizualizovaná farbením etídium bromidom. DNA izolovaná pomocou systému ReliaPrep&trade Large Volume HT gDNA Isolation System poskytla DNA s rozsahom veľkosti 20–125 kb purifikáciou na báze precipitácie izolovanú DNA s rozsahom veľkosti 20–200 kb, zatiaľ čo metódy založené na stĺpcoch preukázali gDNA s veľkosťou 20–75 kb.

Existuje možnosť nízkovýkonnej izolácie gDNA až z 32 vzoriek naraz, keď sa magnetický prístroj Heater Shaker (HSM 2.0 Cat. # A2715) používa na stole, v porovnaní s integrovaným na manipulátore s kvapalinou, kde používateľ dávkuje a nasáva. činidlá zo vzoriek podľa pokynov softvéru na obrazovke počítača. Vopred naprogramované metódy riadia zahrievanie, pretrepávanie, magnetizáciu a načasovanie krokov potrebných pre poloautomatické čistenie.

Okrem plnej krvi možno spracovať aj rôzne iné typy vzoriek, vrátane stabilizovaných slín, vzoriek bukálneho výplachu, krvných frakcií, buffy coat, peliet červených krviniek a všetkých bunkových peliet. Pre plne automatizované čistenie môže byť HSM 2.0 Instrument integrovaný s robotickou pracovnou stanicou na manipuláciu s kvapalinami.

Automatizácia činidiel na prístrojové vybavenie vyžaduje starostlivo naplánovaný a vykonaný prístup. Spolupráca so spoločnosťou Promega vám poskytuje prístup k vedcom, ktorí navrhli automatizovanú purifikáciu pre stovky laboratórií v rámci širokej škály typov vzoriek.

Automatizácia činidiel na prístrojové vybavenie vyžaduje starostlivo naplánovaný a vykonaný prístup. Spolupráca so spoločnosťou Promega vám poskytuje prístup k vedcom, ktorí navrhli automatizovanú purifikáciu pre stovky laboratórií v rámci širokej škály typov vzoriek.

Obrázok 10. Automatizované výťažky DNA pre krvné frakcie. Výťažok DNA je lineárny vzhľadom na pôvodné objemy krvi. Panel A. Výťažky DNA stanovené spektrofotometrom NanoDrop. Panel B. Výťažky DNA sa stanovili pomocou systému QuantiFluor&trade dsDNA. Všetky vzorky boli pripravené od jedného darcu. Manuálne vzorky boli spracované pomocou súpravy Wizard® Genomic DNA Purification Kit. Každý bod je priemerom n=4 hodnôt s chybovými úsečkami 1 štandardnej odchýlky.

Vlastné HT čistenie nukleových kyselín

Implementácia automatizovaných technológií čistenia nukleových kyselín do vášho vysoko výkonného pracovného postupu môže byť náročná a časovo náročná. Naši odborníci na podporu v teréne vám môžu poskytnúť podporu, ktorú potrebujete, aby ste mohli začať.

Vybrané súpravy na čistenie DNA podľa typu vzorky

Zistite viac o niektorých našich špecializovaných súpravách nižšie a preskúmajte šírku nášho portfólia a porovnajte naše súpravy na extrakciu DNA pomocou našej stránky porovnávania produktov, aby ste našli správne riešenie pre vaše potreby čistenia DNA.

Fixná tkanivová izolácia genómovej DNA

MagneSil® Genomic, Fixed-Tissue System (kat. č. MD1490) poskytuje rýchlu a jednoduchú techniku ​​na prípravu genómovej DNA z tkaniva fixovaného vo formalíne a zaliateho parafínom. Po celonočnom štiepení proteinázou K môže byť genómová DNA manuálne purifikovaná z tenkých tkanivových rezov FFPE za menej ako hodinu. Amplifikovateľná genómová DNA môže byť izolovaná z 10 μm rezov bez centrifugácie lyzátu pred čistením. Pomocou magnetického separačného stojana MagneSphere® Technology (kat. č. Z5332, Z5342) je možné spracovať až 12 vzoriek v manuálnom formáte.

Obrázok 11. Analýza DNA purifikovanej z 10 um tenkých rezov fixovaných vo formalíne zaliatych do parafínu pomocou systému MagneSil® Genomic, Fixed Tissue System. Purifikovaná DNA sa amplifikovala a produkty amplifikácie sa analyzovali na genetickom analyzátore ABI PRISM® 310 alebo 3100. Panel A. Amplifikácia so sadou 16 fluorescenčne značených primerov. Zosilňovacie produkty majú veľkosť od 104 do 420 báz. Panel B. Fragment s 972 bázami amplifikovaný s použitím sady amelogenínových primérov. Panel C. 1,8 kb fragment amplifikovaný z Adenomatosis polyposis coli (APC) gén. Predĺženie času predĺženia počas amplifikácie môže pomôcť vyvážiť výťažky medzi malými a veľkými amplifikačnými produktmi a zvýšiť výťažky pre veľké amplifikačné produkty. Výsledky sa budú líšiť v závislosti od stupňa zosieťovania v dôsledku fixácie formalínu.

Jednou z výhod tohto systému oproti iným purifikačným metódam, ako je extrakcia fenol:chloroform, je jeho schopnosť odstrániť väčšinu inhibítorov amplifikácie, vrátane veľmi malých fragmentov DNA. Tkanivo, ktoré bolo uložené vo formalíne dlhší čas, môže byť príliš zosieťované alebo príliš degradované na to, aby dobre fungovalo ako templát na amplifikáciu. Obrázok 11 ukazuje amplifikáciu 16 lokusov krátkych tandemových opakovaní (STR) a ukazuje, ako dobre môže izolovaná DNA fungovať v multiplexnej PCR s použitím systému PowerPlex® 16 HS (kat. č. DC2101, DC2100).

Maxwell® RSC FFPE Plus DNA Kit (kat. č. AS1720) je automatizovaná metóda na čistenie až 48 vzoriek z jedného až desiatich 5μm rezov vzoriek tkaniva FFPE na prístroji Maxwell® RSC (kat. č. AS4500 1–16 kaziet na cyklus) alebo Maxwell® RSC 48 Instrument (kat. č. AS8500 1–48 vzoriek na cyklus). Chémia FFPE Plus je navrhnutá tak, aby poskytovala vysoký výťažok DNA z FFPE pri meraní spektroskopiou, ktorá je vhodná pre amplifikačné aplikácie vrátane qPCR, multiplexnej PCR a NGS. Protokol poskytuje flexibilitu buď s 1-hodinovou rýchlou deparafinizáciou alebo 24-hodinovým nočným protokolom, aby vyhovoval vašim potrebám pracovného toku.

Maxwell® RSC DNA FFPE chémia je najnovšou technológiou FFPE spoločnosti Promega a bola navrhnutá tak, aby poskytovala vysoko amplifikovateľnú DNA. Ušetrite čas a prácu použitím chémie FFPE s nástrojmi Maxwell® a vyhnite sa vystaveniu nebezpečnému xylénu používanému v iných produktoch na čistenie FFPE. Naše testovanie kvality tiež nepreukázalo prakticky žiadne inhibítory PCR vo vzorkách purifikovanej DNA, vďaka čomu je vaša PCR a ďalšie následné aplikácie hračkou.

Využitím rovnakej chémie ako Maxwell® RSC FFPE DNA, Maxwell® HT DNA FFPE Isolation System (kat. č. A6372) poskytuje jednoduchú a spoľahlivú metódu pre vysoko výkonnú a rýchlu izoláciu genómovej DNA zo vzoriek tkaniva FFPE. Systém nevyžaduje organické rozpúšťadlo, vďaka čomu je jeho použitie bezpečné a pohodlné, a purifikovaná DNA sa môže použiť priamo v rôznych následných aplikáciách, vrátane PCR a NGS.

Maxwell® HT DNA FFPE Isolation System čistí nukleovú kyselinu pomocou paramagnetických častíc, ktoré poskytujú mobilnú pevnú fázu na optimalizáciu väzby, premývania a purifikácie gDNA. Použitie paramagnetických častíc na izoláciu DNA eliminuje potrebu odstreďovania alebo vákuových potrubí, vďaka čomu je systém vhodný pre plnú automatizáciu.

Keďže vzorky FFPE môžu mať veľmi rozdielnu kvalitu v dôsledku povahy fixácie vzorky a procesu vkladania, kontrola kvality vzoriek môže byť dôležitou súčasťou pracovného postupu FFPE.

Obrázok 12. Porovnávacie údaje Maxwell® RSC DNA FFPE chémie versus Maxwell® RSC FFPE Plus chémie DNA. Zistilo sa, že metóda Maxwell® RSC FFPE Plus DNA poskytuje vyšší výťažok absorbanciou a fluorescenciou, zatiaľ čo metóda Maxwell® RSC DNA FFPE poskytuje vyšší výťažok pomocou PCR.

Spektrofotometria je bežný spôsob hodnotenia kvality extrahovanej DNA a RNA. Väčšina laboratórií má mikroobjemový spektrofotometer NanoDrop (alebo podobné zariadenie) a jeho použitie je neuveriteľne jednoduché. Napipetujte 1-2 µl vzorky, zvoľte „Analyze“ a prístroj poskytne odčítanie koncentrácie a čistoty pomocou A260/A280 a A.260/A230 pomery v priebehu niekoľkých sekúnd. Tieto zariadenia spôsobili revolúciu v rutinnom kvantifikácii vzoriek v laboratóriu, ale je to najlepšia metóda na hodnotenie vzoriek FFPE? Pri používaní NanoDrop sú dve hlavné úvahy: citlivosť a integrita. Vzorky FFPE môžu mať široký výťažok DNA alebo RNA, často len 10 ng alebo menej v objeme od 10 ul do 100 ul z extrakcie. Výsledkom môžu byť koncentrácie vzoriek pod lineárnym rozsahom NanoDrop. Navyše ako spektrofotometer nerozlišuje medzi RNA, DNA alebo voľnými nukleotidmi, čo môže viesť k dramatickým nepresnostiam v meraní koncentrácie DNA/RNA. Nakoniec neexistuje žiadny spôsob, ako určiť, či je vzorka prístupná pre následné enzymatické testy, pretože nemôže detekovať prítomnosť alebo neprítomnosť priečnych väzieb (alebo iného poškodenia) vo vzorke.

Kvantifikácia na báze farbiva ako Promega QuantiFluor® dsDNA System (kat. č. E2670, E2671), poskytuje rýchlu a výrazne citlivejšiu metódu na kvantifikáciu dsDNA alebo RNA v porovnaní s absorbančnou spektroskopiou. Táto metóda poskytuje všeobecne užitočný odhad koncentrácie. Pri zvažovaní vzoriek FFPE je dôležité poznamenať, že kvantifikácia na báze farbiva neodhaľuje integritu DNA/RNA ani rozsah zosieťovania vo vzorke, čo by mohlo ovplyvniť úspech v následných testoch.

Stanovenie veľkosti (napr. agarózový gél, pásková stanica, analyzátor fragmentov, DV200) môže poskytnúť odhad koncentrácie a – čo je dôležitejšie – informácie o distribúcii veľkosti fragmentov vo vzorke. DNA odvodená z FFPE môže byť vďaka procesu fixácie výrazne fragmentovaná v porovnaní s DNA z čerstvo zmrazeného tkaniva. Nižšie je záznam analyzátora fragmentov (obrázok 13) a súvisiace skóre DV200 (tabuľka 3) DNA izolovanej z rezov FFPE s použitím piatich rôznych purifikačných metód. Zatiaľ čo stopy veľkosti hodnotia distribúciu purifikovanej veľkosti DNA, nemerajú stupeň zosieťovania vo vzorke ani prítomnosť inhibítorov.

Obrázok 13. Stopa fragmentového analyzátora DNA izolovanej z rezov FFPE pomocou piatich rôznych purifikačných metód.

Tabuľka 3. DV200 skóre DNA izolovanej z FFPE rezov s použitím piatich rôznych purifikačných metód v zázname fragmentového analyzátora (obrázok 13).

Metóda 1 (svetlozelená) 2 (modrá) 3 (červená) 4 (oranžová) 5 (zelená)
DV200 71.8 69.9 70.1 58.7 80.5

Napríklad, keď boli rovnaké vzorky kvantifikované pomocou qPCR testov rôznych cieľov a veľkostí fragmentov, výťažok pomocou qPCR dobre nekoreluje so skóre DV200. V skutočnosti v tomto príklade mali vzorky s najnižším skóre DV200 najväčší výťažok pomocou qPCR (obrázok 14).

Obrázok 14. Výťažky qPCR DNA izolovanej z rezov FFPE. The same samples of DNA isolated by five different purification methods in the fragment analyzer trace and DV200 table above were quantitated by qPCR assays of various targets and fragment sizes.

While there are general trends, the DV200 score does not necessarily correlate with success in downstream assays such as qPCR.

qPCR has several advantages for the quantitation of FFPE samples. First, qPCR can be very sensitive, requiring only a small amount of sample and detecting pg/µl amounts of DNA. In terms of sensitivity in nucleic acid detection, it is surpassed only by ddPCR. qPCR can also provide a measure of how degraded or crosslinked a DNA sample may be since nucleic acid must be a suitable substrate for a DNA polymerase for a signal to be generated. Absorbance may not represent the sample suitable for the downstream assay because it will detect DNA, fragmented DNA and nucleotides. Finally, most qPCR QC assays, such as the ProNex® DNA QC Assay (Cat.# NG1004, NG1005) provide internal controls which are used to detect the presence of inhibitors in the sample prior to attempting a more expensive assay. This can help you assess not only the integrity of the nucleic acids, but also the likelihood of an amplification-based assay to be successful.

NGS is another assay used by some labs to QC their samples. There are several reasons for this. Some labs are trying to get as much data as possible from very precious samples, in which case any sequence information may be worth the expense and risk of failed sequencing runs. As a QC test, NGS may provide a lot of information, but it is expensive and can require large amounts of sample and time. Some labs run low pass NGS, which uses highly-multiplexed samples to lower the cost per sample to determine if it is worth the time and resources to sequence deeper. Most sequencing and purification providers recommend qPCR assays to quantitate FFPE DNA, as all NGS workflows depend primarily on the success of enzymatic amplification steps to obtain sequencing-ready DNA as part of library preparation steps.

Table 4. Comparative Pros and Cons of Various QC Assays.

Metóda Rýchlosť Citlivosť Quantitative? Measure Purity? Assess size of NA? Detect Cross- linking? Náklady
Spectrophotometry (NanoDrop) +++ + Semi - quantitative + - - $
Dye-Based Quantitation +++ ++ Y - - - $
DV200 ++ + Semi - quantitative - +* - $$
Gélová elektroforéza ++ +/- Semi - quantitative - +* - $
qPCR ++ +++ Y +* + + $
NGS + Y + ++ + $$$

Plant Genomic DNA Isolation

The Wizard® Magnetic 96 DNA Plant System (Cat.# FF3760, FF3761) is designed for manual or automated 96-well purification of DNA from plant leaf and seed tissue. The Wizard® Magnetic 96 DNA Plant System has been validated with corn and tomato leaf as well as with canola and sunflower seeds. The DNA purified from these samples can be used in PCR and other more demanding applications, such as RAPD analysis. Since plant materials can be particularly challenging to lyse, especially when working with tough or woody tissues, additional required equipment includes not only a magnet (MagnaBot® FLEX 96 Magnetic Separation Device, Cat.# VA1920) but also a device capable of breaking up seed or leaf material (e.g., Geno/Grinder® 2000 from SPEX CertiPrep, Inc.).

The yield depends on the source material and how well the seeds or leaf disks are pulverized prior to the genomic DNA isolation. Yield may range from 10–100ng from a single 8mm leaf punch. To increase the yield from the Wizard® Magnetic 96 DNA Plant System, a scale up in volume with up to 5 leaf punches can be used [as demonstrated in Promega Notes 79]. The potential scale-up is limited by the volume in a deep-well, 96-well plate.

Another automated option we have to meet your plant DNA extraction needs, is the Maxwell® RSC Plant DNA Kit (Cat.# AS1490). The Maxwell® RSC Plant DNA Kit is used with the Maxwell® RSC and RSC 48 Instruments to provide an easy method for efficient, automated purification of genomic DNA (gDNA) from a range of plant tissue samples, including corn, soybean and Arabidopsis. The Instruments are supplied with preprogrammed purification methods and uses predispensed reagent cartridges, maximizing simplicity and convenience.

Using this system, DNA can be purified from plant samples in under 60 minutes with minimal preprocessing and no organic extractions. Automated purification results in consistent purification, with less variability than traditional DNA extraction methods such as CTAB and spin-columns. The resulting purified DNA is ready to use in downstream applications, including amplification assays.

Serum-Plasma Genomic DNA Isolation

For high quality, purified cell-free DNA from plasma samples, we offer the Maxwell® RSC ccfDNA Plasma Kit (Cat.# AS1480). Utilizing the simple three-step protocol, the Maxwell® RSC Instrument can process 1 to 16 samples, and the Maxwell® RSC 48 Instrument can process 1 to 48 samples. Simply add 0.2–1.0ml of plasma to the prepared cartridges and select Start, no preprocessing of samples required. In approximately 70 minutes, you will have high yields of amplifiable DNA that is ready to be used in downstream assays including qPCR, NGS and digital PCR.

As a magnetic particle mover, not a liquid handler, the Maxwell® RSC additionally offers several advantages over other automated systems. Since no liquid handling or splashing occurs during sample processing, there is minimal risk of sample cross-contamination. It also eliminates the worry of potential clogs and inevitable system breakdowns that follow, ensuring a smooth workflow with fewer disruptions.

Bacterial Genomic DNA Isolation

If you need to make quick decisions about potential food contamination and spoilage, the Maxwell® RSC PureFood Pathogen Kit (Cat.# AS1660) offers a simple automated protocol with minimal hands-on steps. The kit effectively eliminates laborious sample preprocessing steps such as enzymatic pretreatment, as it works with inhibiting sample types and also has the ability to lyse both Gram+ or Gram– bacteria.

By coupling the high-performance Maxwell® chemistries with the trusted benchtop Maxwell® RSC instruments, you will be able to effectively purify bacterial DNA from up to 48 food samples in as little as 40 minutes. Once extracted, the resulting DNA is ready for advanced downstream molecular analyses, including serotyping, NGS and identification of spoilage organisms.

This method can be utilized for both raw and processed food and has successfully been used to isolate pathogen DNA from a wide variety of food samples, including E. coli 0157:H7 from uncooked beef, Salmonella enterica from uncooked chicken and Listeria monocytogenes from whole milk. Figure 15 below highlights a comparison of total DNA versus E. coli 0157:H7 DNA extracted from cilantro samples that were spiked with the E. coli 0157:H7 bacteria.

Figure 15. Comparison of total DNA and E. coli 0157:H7 DNA extracted from cilantro samples spiked with the indicated amounts of E. coli 0157:H7 bacteria. The total DNA concentration was assessed using the QuantiFluor® ONE dsDNA System.

Buffy Coat Genomic DNA Isolation

The Maxwell® RSC Buffy Coat DNA Kit (Cat.# AS1540) provides a simple, automated method of genomic DNA extraction using the convenient, prefilled cartridge format of the Maxwell® RSC Instrument. The kit contains all the reagents you need for optimal DNA extraction, and is compatible with blood stored in EDTA, heparin and citrate anticoagulants. Avoid the tedious and time-consuming hassle of preprocessing samples, simply add 50–250μl of your sample directly into well #1 of the cartridges. Your purified DNA is ready for analysis in about 50 minutes, and can be used directly in various downstream applications, such as agarose gel electrophoresis.

Food Genomic DNA Isolation

Food and plant materials often provide the greatest challenge for cell lysis and intact DNA extraction, due to the lysis conditions required to liberate the nucleic acid and the processing of plant materials into comestibles.

Another specialized genomic DNA isolation system is the Wizard® Magnetic DNA Purification System for Food (Cat.# FF3750, FF3751). This convenient protocol is designed for the manual purification of DNA from a variety of food samples including corn seeds, cornmeal, soybeans, soy flour and soy milk, generating results in one-third of the time of traditional methods. In addition, DNA can be purified from processed food such as corn chips, chocolate and chocolate-containing foods, lecithin and vegetable oils if used with the appropriate optimized protocols.

The DNA purified from many of these samples can be used in PCR-based testing for Genetically Modified Organism (GMO) DNA sequences, such as by quantitative analysis using TaqMan® assays. As with all isolation systems using the MagneSil® PMPs, a magnetic separation stand is needed and enables processing of up to 12 samples per batch. With samples containing highly processed food, the genomic DNA isolated will be fragmented and better suited for analysis using amplification rather than a Southern blot. The yield of DNA from this system will vary depending on source type and extent of food processing.

The Maxwell® RSC PureFood GMO and Authentication Kit (Cat.# AS1600) provides an easy and automated method for efficient purification of DNA for PCR-based food and ingredient authentication. The Kit is used with the Maxwell® RSC and RSC 48 Instruments and can purify DNA from raw and processed food samples, including corn, soybeans, canola, ground beef and ground pork.

100 minute protocol requires only 30 minutes of hands-on time, effectively achieving not only faster results with walk-away automation, but also freeing up laboratory resources for higher value activities. The purified DNA extracted using the PureFood Kit is ready to be used for several applications, including real-time PCR, gel electrophoresis, next-generation and Sanger sequencing and microarrays.

Nucleic Acid Purification Protocols for Plant & Food Sample Types

Explore our collection of protocols for manual and automated DNA or RNA extraction from a variety of food and plant samples.


  • A series of lab exercises giving instructions for the extraction of DNA from several different starting materials. The exercise is designed for the 6-12 grade level.

The following resources were originally accessed through the BioSciEd Net (BEN) digital resources collection, which is the National Science Digital Library (NSDL) Pathway for biological sciences education. For more teaching resources, please visit BEN to use their searchable database. BEN is free to use, but requires registration.

    - This lab, from AccessExcellence enables students to work with DNA concretely by easily isolating chromosomal DNA using the same basic tools and methods that scientists use. - this Science NetLinks website provides lesson plans that develop understanding of DNA by modeling the process of DNA extraction.
  • [link https://web.archive.org/web/20190222033127/http://www.apsnet.org/edcenter/K-12/TeachersGuide/DNA_Easy/Pages/default.aspx 'DNA the Easy Way (and Gram Stain Without the Mess)'] - This resource, by the American Phytopathological Society, is a short laboratory exercise that teaches students the procedures of DNA isolation from bacterial cells. In addition, students learn how to determine the Gram-stain reaction of bacterial isolates. : This Access Excellence resource provides a laboratory activity where students use DNA fingerprinting analysis to determine the perpetrator of a fictitious crime. - This resource requires you to log in to BEN to view (which requires a subscription to BEN, which is free). This PDF document offers a detailed manual of protocols and instructional information for carrying out an undergraduate laboratory exercise in molecular biology and cenetics, in which students use polymerase chain reaction to create DNA fingerprints from their own hair. It includes student outlines, instructor's notes, and suggested questions for laboratory reports.

O

Znovu použiť

Materiál na tejto stránke je ponúkaný pod licenciou Creative Commons, pokiaľ nie je nižšie uvedené inak.


DNA purification by isopropanol precipitation

Úvod

Isopropanol precipitation is a simple method for DNA purification. Here, a protocol which I adopted in my former experiments is introduced. Alternatively, DNA-containing solution can be mixed with the same volume of isopropanol, then treated just like the protocol for ethanol precipitation. We have also tried DNA purification by &lsquoCTAB precipitation&rsquo method, but this trial was far from successful [1].

Reagent

High-Salt Solution for Precipitation (Takara, Kusatsu, Japan).

Protokol

Be careful so as not to directly touch isopropanol with your skin.

Add half volume (of DNA solution) of High-Salt Solution for Precipitation and mix.

Add the same volume (as High-Salt Solution for Precipitation) of isopropanol and mix. Place at room temperature for 10 min. Centrifuge at the maximum speed for 10 min at 4°C. Discard supernatant.

Add 1 mL of 70% ethanol. Place at &minus80°C for 15 min.

Thaw out sample and immediately proceed to centrifugation at the maximum speed for 5 min at 4°C. Discard all supernatant and dry.


Purification and concentration of DNA from aqueous solutions

This unit presents basic procedures for manipulating solutions of single- or double-stranded DNA through purification and concentration steps. The Basic Protocol, using phenol extraction and ethanol precipitation, is appropriate for the purification of DNA from small volumes (<0.4 ml) at concentrations <1 mg/ml. Isopropanol may also be used to precipitate DNA, as described in an alternate protocol. Three support protocols outline methods to buffer the phenol used in extractions, concentrate DNA using butanol, and extract residual organic solvents with ether. An alternative to these methods is nucleic acid purification using glass beads, and is described here. These protocol may also be used for purifying RNA. The final protocols provide modifications to the Basic Protocol that are used for concentrating RNA and extracting and precipitating DNA from larger volumes and from dilute solutions, and for removing ow-molecular-weight oligonucleotides and triphosphates.


Make a chart (with diagrammatic representation) showing a restriction enzyme, the substrate DNA on which it acts, the site at which it cuts DNA and the product it produces.

â–² Fig. 7.3. EcoRI cuts the DNA between bases G and A only when the sequence GAATTC is present in the DNA.


DNA Extraction Protocol for Plants with High Levels of Secondary Metabolites and Polysaccharides without Using Liquid Nitrogen and Phenol

Mangroves and salt marsh species are known to synthesize a wide spectrum of polysaccharides and polyphenols including flavonoids and other secondary metabolites which interfere with the extraction of pure genomic DNA. Although a plethora of plant DNA isolation protocols exist, extracting DNA from mangroves and salt marsh species is a challenging task. This study describes a rapid and reliable cetyl trimethylammonium bromide (CTAB) protocol suited specifically for extracting DNA from plants which are rich in polysaccharides and secondary metabolites, and the protocol also excludes the use of expensive liquid nitrogen and toxic phenols. Purity of extracted DNA was excellent as evident by A260/A280 ratio ranging from 1.78 to 1.84 and A260/A230 ratio was >2, which also suggested that the preparations were sufficiently free of proteins and polyphenolics/polysaccharide compounds. DNA concentration ranged from 8.8 to 9.9 μg μL −1 . The extracted DNA was amenable to RAPD, restriction digestion, and PCR amplification of plant barcode genes (matK and rbcl). The optimized method is suitable for both dry and fresh leaves. The success of this method in obtaining high-quality genomic DNA demonstrated the broad applicability of this method.

1. Úvod

The isolation of pure, intact, and high-quality DNA is very crucial for any molecular studies [1]. However, DNA isolation from plants is usually compromised by excessive contamination by secondary metabolites. The DNA isolation methods need to be adjusted to each plant species and even to each plant tissue because of the presence of these metabolites, unlike animals and microbes [2]. The search for a more efficient means of extracting DNA of both higher quality and yield has led to the development of several protocols for isolating DNA from plants containing high levels of secondary metabolites [3–7]. The mangroves and salt marsh are specially adapted to harsh environment such as marshy anoxic anaerobic soil and fluctuating salinity of the water bodies [8]. To avoid these stress conditions mangroves and salt marsh plants synthesize high amounts of polysaccharides, polyphenols, and other secondary metabolites such as alkaloids and flavanoids which impede DNA extraction [9, 10].

Many factors can cause shearing of DNA during extraction. Degradation of DNA due to endonucleases is one such problem encountered in the isolation and purification of high molecular weight DNA from plant, which directly or indirectly interfere with the enzymatic reactions [11]. Polysaccharides may be particularly problematic when present in DNA samples, as their presence may also inhibit enzymatic activity. Presence of polysaccharides has been shown to inhibit Taq polymerase activity [12] and restriction enzyme activity [13]. The presence of polysaccharides in the DNA sample is characterized by formation of a highly viscous solution [14]. The oxidized form of polyphenols covalently binds to DNA giving a brown colour and reduces maintenance time, making it useless for molecular studies [15].

Apart from traditional extraction approaches, several commercial kits are also accessible to extract genomic DNA from plants with sufficient quality [16]. For extracting genomic DNA an initial mechanical grinding of the leaf sample is carried out in the presence of liquid nitrogen, where the ultimate aim is to access the nuclear material without degradation. Numerous DNA isolation protocols use phenol to separate cellular molecules and debris from the DNA which is toxic, hazardous, expensive, and require special containment facilities to maximize personnel safety and minimize environmental concerns. However, the convenience provided by the above-mentioned methods may be cost prohibitive when considering experiments with limited financial resources.

Several researchers have attempted to eliminate the use of hazardous chemicals, expensive kits, equipment, and labour-intensive steps for high throughput DNA extraction. However, these methods do have demerits such as limited shelf life, low purity, low recovery, and poor amplification [17, 18]. Mostly the DNA extraction protocols recommend fresh leaf samples for genomic DNA isolation, but it seems impractical when the samples are collected from remote and rare locations. These situations necessitate the development of the protocols for isolating DNA from dried leaf samples. The objective of this study was to develop a simple method to isolate DNA in an open laboratory environment, a method that eliminates the need to use liquid nitrogen and toxic phenol. The resulting optimized CTAB (Cetyl trimethylammonium bromide) protocol enables the isolation of high quality genomic DNA amenable to RAPD (Random amplified Polymorphic DNA), restriction digestion, and amplification of plant barcode genes (matK and rbcl) with reduced cost and health concerns.

2. Materials and Method

2.1. Plant Samples for DNA Isolation

Young, tender, and unbruised leaves of mangroves (Rhizophora mucronata, Rhizophora apiculata, Aegiceras corniculatum, Lumnitzera racemosa, Lumnitzera littorea, Bruguiera gymnorrhiza, Bruguiera cylindrica, Scyphiphora hydrophyllacea, Avicennia marina, Avicennia officinalis, a Xylocarpus mekongensis) and salt marsh (Suaeda maritima a Sesuvium portulacastrum) were collected from Pichavaram Mangrove Forest, Tamil Nadu, India and stored in −80°C until use. The leaves were preferred for DNA extraction due to their continued availability whole year round. A minimum of ten accessions were taken for each genus. Dried leaves of Rhizophora a Avicennia sp. were also taken to scrutinize the applicability of the optimized extraction protocol.

2.2. Extraction Methods

Plant genomic DNA extraction Kit (GeNei), CTAB DNA extraction method by Porebski et al. [4], J. J. Doyle and J. L. Doyle [19], and Saghai-Maroof et al. [20] were employed for extracting DNA from the study plants. Among all the tested protocols, Saghai-Mahroof method yielded convincing results. Therefore, this method was taken and optimized for DNA extraction by varying the concentration of Tris-HCl, NaCl (Sodium Chloride),

-mercaptoethanol, and PVP (PolyVinyl Pyrrolidone).

2.3. Standardized Extraction Method

(i) Preheat suspension buffer (pH 8) containing 50 mM EDTA, 120 mM Tris-HCl, 1 M NaCl, 0.5 M sucrose, 2% Triton-X 100, and 0.2% -mercaptoethanol (to be freshly added just before use) in water bath at 60°C. (ii) Grind −80°C stored leaves (1 g) to fine powder in ice cold condition in the presence of 250 mg PVP (PolyVinyl Pyrrolidone, Mr 10,000) by using pre chilled mortar and pestle (−40°C/−80°C).

Poznámka: To avoid usage of liquid nitrogen, this method is successfully employed. If −80°C is not available, −40°C/−20°C can also be used. Lower the temperature and lower will be the chances of DNA degradation (nuclease activity). Appearance of brown colour indicates DNA degradation. (iii) Transfer the content in 2 mL microcentrifuge tubes and suspend in two volumes of suspension buffer. (iv) Invert and mix gently and incubate at 60°C for 40 min. (v) Centrifuge the suspension at 10,000 rpm for 15 min at room temperature. (vi) Add 1.5 mL of extraction buffer containing 20 mM EDTA, 100 mM Tris-HCl, 1.5 M NaCl, 2% CTAB, 1% -mercaptoethanol and incubate at 60°C for 30 min. (vii) Centrifuge at 12,000 rpm for 15 min at room temperature. (viii) Carefully transfer the aqueous phase into a new tube.

Poznámka: Use wide-bore tips for transferring the aqueous phase to avoid mechanical damage to DNA. (ix) Add double volume of Chloroform: Isoamyl alcohol (24 : 1), and invert gently 15 to 20 times and centrifuge at 12,500 rpm for 15 min.

Poznámka: If the aqueous layer appears translucent, repeat the step until the solution is transparent. (x) Add double volume of chilled isopropanol and keep at −20°C for one hour to precipitate the DNA.

Poznámka: The longer the chilled incubation, the more the precipitation. (xi) Centrifuge at 12,000 rpm for 15 min and discard the supernatant. (xii) To the pellet, add 70% chilled ethanol and spool out the pellet carefully and centrifuge again at 12,000 rpm for 15 min. (xiii) Discard the supernatant and vacuum dry or air dry the pellet at room temperature.

Poznámka: Make sure that there is no residual ethanol, this is very critical especially if the DNA is to be used directly for PCR. Overdrying should also be avoided as it makes the pellet difficult to resuspend. (xiv) Add 100

L of high salt TE buffer (0.5 M NaCl, 10 mM Tris-HCl, 1 mM EDTA (pH 8). (xv) Add 3 L RNase (10 mg/mL) and keep at 37°C for 30 min followed by chloroform: isoamyl alcohol extraction and ethanol precipitation in the presence of 3 M sodium acetate (pH 5.2). (xvi) Spool out the DNA, wash in 70% ethanol, air or vacuum dry. (xvii) Add 30 to 50 L (depending upon the pellet) of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8) to dissolve the precipitate.

Poznámka: Chelator present in TE can affect PCR and restriction digests. DNA in TE should be suitably diluted before use in such reactions. (xviii) Store at −20°C/−40°C till further use.

2.4. Qualitative and Quantitative Analysis of Extracted DNA

The DNA yield was measured by using a UV-Visible spectrophotometer (Perkin Elmer) at 260 nm. DNA purity was determined by calculating the absorbance ratio A260/280. Polysaccharide contamination was assessed by calculating the absorbance ratio A260/230 [21]. For quality and yield assessments, electrophoresis was done of all DNA samples in 0.8% agarose gel, stained with Ethidium Bromide and bands were observed in gel documentation system (Alpha Innotech).

2.5. Random Amplified Polymorphic DNA (RAPD) Study

The PCR amplification reaction was carried out with five random decamer primers (Rpl1 do Rpl5) obtained from GeNei (Bangalore) in a 25 L reaction volume containing 10 mM Tris-HCl, pH 8.3, 2.5 mM MgCl2, 1 mM dNTP mix, 0.2 M of each primer, 1 U of Taq DNA polymerase, and 15 to 40 ng of template DNA. RAPD-PCR was performed in a thermalcycler (Tech Gene) for 40 cycles consisting of denaturation at 94°C for 30 sec, annealing at 45°C for 30 sec, and extension at 72°C for 60 sec. The final extension was carried out at the same temperature for 5 min. The amplified product was checked in 1.5% agarose gel electrophoresis and bands were observed in gel documentation system (Alpha Innotech).

2.6. Restriction Fragment Length Polymorphism (RFLP) Study

The extracted DNA was subjected to RFLP study [22]. Briefly, the reaction mixture was prepared by adding 10 L of extracted DNA, 15 L of 2X assay buffer, 10 L of BSA, and 3 L of restriction enzyme (Bam hI, ECORI and PstI). The vials were incubated at 37°C for 1 hr for complete digestion. The restriction enzyme digested products were visualized through silver staining of the polyacrylamide gel. The gels were fixed in 50 mL of fixing solution (diluted five times with 30.4 mL double-distilled water and 9.6 mL ethanol) for 30 min and silver-impregnated (with 1X staining solution) for another 30 min. This was followed by washing the gels in double-distilled water for 1 to 2 min. After removing the staining solution the gels were then kept in the developing solution in dark for 10 min. When the bands were dark enough, the developing solution was poured out and the stopping and preserving solution was immediately added.

2.7. matK and rbcl Gene Amplification

PCR amplification of matK (trnK-F: gggttgctaactcaatggtagag trnK-R: tgggttgcccggggccgaac) and rbcl (rbcl-F: actgtagtaggtaaacttgaaggtgaacg rbcl-R: gaaccttcctcaaaaaggtctaaggggta) were carried out in 25 L reaction containing 1.0 U Taq DNA polymerase, 1 mM dNTPs-Mix, 1XTaq buffer, 2.5 mM MgCl2, 20 mM of each amplification primer, and 10–50 ng of template DNA in a one-step touchdown PCR-program (1 cycle at 90 sec at 96°C, 60 sec at 50°C, 120 sec at 68°C, 35 cycles at 30 sec at 95°C, 60 sec at 48°C, 120 sec at 68°C, subsequent final elongation of 20 min at 68°C) [23]. Annealing temperature (

) ranged from 47 to 50°C with respect to different plant species. The amplified products were separated by electrophoresis in 1.5% agarose gel buffered with 1X TAE. Gels were stained with ethidium bromide, and bands were observed in gel documentation system (Alpha Innotech).

3. Výsledky a diskusia

Plant genomic DNA extraction Kit (GeNei) did not show promising results for mangroves and salt marsh species as evident by the presence of sticky polysaccharides in the pellet and sheared band in the agarose gel. We encountered many difficulties from the very first step of cell lysis to DNA separation in the supernatant and subsequent reactions when the CTAB DNA extraction method of Porebski et al. [4] and J. J. Doyle and J. L. Doyle [19] was followed. Highly viscous and sticky pellets were difficult to handle and the brownish pellet, indicated contamination by phenolic compounds [24]. The amount of DNA obtained with these protocols was very low, and the quality was also poor for most of the samples. A260/A280 ratio was less than 1.6, that is, below the optimal limit of 1.8 [25] making the DNA nonamenable for molecular studies. But, interestingly the CTAB method described by Saghai-Maroof et al. [20] gave better DNA yield in terms of quality and quantity from the study plants. Hence, this method was considered for the purpose of standardization at varying concentration of Tris-HCL, -mercaptoethanol, NaCl, and PVP (Figure 1).


Genomic DNA isolated from plant leaves resolved under 0.8% agarose gel. Lane1 shows the DNA isolated by using Plant genomic DNA extraction Kit (GeNei) Lane2, Lane3, and Lane4 shows the isolated DNA by the CTAB method described by J. J. Doyle and J. L. Doyle [19] Porebski et al. [4] and Saghai-Maroof et al. [20] respectively. Lane5 to Lane8 represents the isolated DNA by the present optimized extraction method (Lane1 to Lane4 represents A. marina Lane5 represents the isolated DNA from salt marsh (Suaeda maritima) Lane6 and Lane7 illustrate the isolated genomic DNA from the fresh leaves of A. marina, whereas Lane8 represents the DNA isolated from dried leaves of A. marina).

The success of the optimized extraction method in obtaining high-quality genomic DNA from all the tested mangrove and salt marsh species demonstrated the broad applicability. DNA concentration of the extraction method ranged from 8.8 to 9.9 g L −1 . The use of prechilled mortar and pestle and −40°C/−80°C stored leaf sample successfully substituted the use of costly liquid nitrogen. The final DNA pellets were white with no visible discoloration. It has been reported that high level of -mercaptoethanol successfully removes the polyphenols [26]. Therefore, high concentration of β-mercaptoethanol was used which made the protocol good for extraction of high-quality DNA. The addition of NaCl at concentrations higher than 0.5 M, along with CTAB, is known to remove polysaccharides during DNA extraction [24, 27]. The concentration of NaCl varied with plant species in a range between 0.7 M [28] to 6 M [29]. In the present study, higher level of NaCl (1.5 M) in the extraction buffer further improved the quality of the extracted DNA. The high quality of obtained DNA could also be attributed to the use of a higher concentration of PVP (2.5%) with lower molecular weight (10,000) rather than 40,000. A number of workers [30, 31] have recommended the use of PVP with molecular weight of 10,000 at 2% (w/v) to address the problem of phenolics. PVP with low molecular weight has less tendency of precipitating with the nucleic acids as compared to PVP with high molecular weight thus yielding sufficient amount of polyphenol-free DNA [32].

Purity of extracted DNA was excellent as evident by A260/A280 ratio ranging from 1.78 to 1.84 and A260/A230 ratio was >2, suggesting that the preparations were sufficiently free of proteins and polyphenolics/polysaccharide compounds [20]. Clear banding patterns were observed in the RAPD study (Figure 2). The extracted DNA was also amenable for RFLP study and amplification of plant barcode genes as evident in Figures 3 and 4, respectively. The successfully amplified barcode genes sequences were sequenced and submitted to Genbank (Accession numbers: JQ433951, JQ421082, JQ511854, and JQ421083)


Concentration of DNA by isopropanol - Biology

Materials: see Solutions for Recipes

  1. Measure the volume of the DNA sample. Adjust the salt concentration by adding 1/10 volume of sodium acetate, pH 5.2, (final concentration of 0.3 M) or an equal volume of 5 M ammonium acetate (final concentration of 2.0-2.5 M). These amounts assume that the DNA is in TE only if DNA is in a solution containing salt, adjust salt accordingly to achieve the correct final concentration. Mix well. Add 2 to 2.5 volumes of cold 100% ethanol (calculated after salt addition). Mix well.
  2. Place on ice or at -20 degrees C for & gt20 minutes.
  3. Spin a maximum speed in a microfuge 10-15 min.Carefully decant supernatant. Add 1 ml 70% ethanol. Zmiešať. Spin briefly. Carefully decant supernatant. Air dry or briefly vacuum dry pellet.
  4. Resuspend pellet in the appropriate volume of TE or water.

This Web page is maintained by Julie B. Wolf, UMBC
Last updated on 3/2/2010

is designed for students interested in careers in industrial and biomedical sciences.