Informácie

2.6: Endoreduplikácia - biológia

2.6: Endoreduplikácia - biológia


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Endoreduplikácia, je špeciálny typ tkanivovo špecifickej amplifikácie genómu, ktorý sa vyskytuje v mnohých typoch rastlinných buniek a v špecializovaných bunkách niektorých zvierat vrátane ľudí. Príkladom je vysoko endoreduplikovaný slinná žľaza polytén chromozómov D. melanogaster (Obrázok ( PageIndex {21} )), ktorý môže mať viac ako 1 000 chromatidov, ktoré sa navzájom zarovnávajú a vytvárajú obrovské chromozómy, ktoré vykazujú vzor pruhov, ktorý odráža základnú sekvenciu DNA a gény v tejto chromozómovej oblasti. Tieto chromozómy boli úžasnými výskumnými modelmi v genetike, pretože ich relatívne veľká, zosilnená veľkosť uľahčuje identifikáciu a štúdium širokej škály chromozómových aberácií pod mikroskopom.

Obrázok (PageIndex{21}): Endoreduplikované chromozómy z bunky slinnej žľazy Drosophila. Pásový vzor je vytvorený fluorescenčnými značkami. (Flickr-Elissa Lei, Ph.D. @ NIH-CCA)


2.6: Endoreduplikácia - biológia

Po prvé, jeho oblasťou výskumu bola cytogenetika rastlín, hlavne týkajúca sa replikácie DNA a bunkového cyklu. Výmeny sesterských chromatidov a chromozómové aberácie boli koncovými bodmi výberu. Po šesťročnom pobyte, ktorý vykonával výskum na španielskej rade pre výskum (Madrid), sa v roku 1980 presťahoval na univerzitu v Seville, kde založil svoj vlastný výskumný tím so záujmom o poškodenie DNA spôsobené rôznymi environmentálnymi mutagénmi, ako aj bunkové mechanizmy, ktoré sa s takýmto poškodením vyrovnávajú. Kým až do roku 1985 boli rastlinné bunky takmer výlučne používaným materiálom, v tom roku sa presťahoval na univerzitu v Uppsale (Švédsko) a neskôr na univerzitu v San Franciscu v Kalifornii (USA), aby sa zoznámil s metodológiami bunkových kultúr in vitro. pre bunky cicavcov a ľudí.

Spolupracuje s riaditeľom výskumného tímu Bunková kultúra a rádiobiológia, ktorý sa v laboratóriu na Biologickej fakulte v Seville (Španielsko) zaväzuje k neustálej aktualizácii cieľov a metodík v dôsledku kontaktov s vedcami na celom svete, ako aj spolupráce a výmen s inými laboratóriami. . Zatiaľ ich hlavné oblasti výskumu využívajúce kultivované bunky cicavcov sú tieto: štúdie radiačnej ochrany uskutočnené v rámci koordinovaných projektov Európskej únie, mechanizmy zapojené do chromozomálnych aberácií a výmeny sesterských chromatidov (na detekciu poškodenia DNA), možná účasť rôznych jadrových enzýmov (hlavne DNA topoizomerázy I a II) pri oprave poškodenej DNA, genotoxické poškodenie vtákov v národnom parku Do & ntildeana (juhozápadné Španielsko) v dôsledku úniku z toxického odpadu z ťažby do rieky Guadiamar a okrem iného prostredníctvom testov andalúzskych a latinskoamerických rastlinných extraktov o ich možnej protinádorovej aktivite. Dr. F. Cort & eacutes je autorom troch učebníc o histológii rastlín a je členom redakčnej rady pre výskum mutácií (Elsevier).

Cantero G, Campanella C, Mateos S, Cortes F.
Inhibícia topoizomerázy II a vysoký výťažok endoreduplikácie indukovanej flavonoidmi luteolínom a kvercetínom.
Mutagenéza. 21. september 2006 (5): 321-5. Epub 2006 1. septembra.
PMID: 16950806 [PubMed-indexované pre MEDLINE] ------

Cantero G, Pastor N, Mateos S, Campanella C, Cortes F.
Cisplatinou indukovaná endoreduplikácia v bunkách CHO: poškodenie DNA a inhibícia topoizomerázy II.
Mutat Res. 2006 Júl 25599 (1-2):160-6. Epub 2006 30. marca.
PMID: 16574165 [PubMed-indexované pre MEDLINE] ------

Mateos S, Hajji N, Pastor N, Cortes F.
Modulácia radiačnej odozvy inhibíciou katalytickej aktivity topoizomerázy II.
Mutat Res. 2006 Júl 25599 (1-2):105-15. Epub 2006 30. marca.
PMID: 16574164 [PubMed-indexované pre MEDLINE] ------

Cantero G, Mateos S, Pastor N, Cortes F.
Halogénová substitúcia DNA chráni pred otravou topoizomerázou II, ktorá má za následok prerušenie dvojvláknovej DNA.
Oprava DNA (Amst). 2006, jún 105 (6): 667-74. Epub 2006, 10. januára.
PMID: 16406738 [PubMed - indexované pre MEDLINE] ------

Lopez-Lazaro M, Pastor N, Azrak SS, Ayuso MJ, Cortes F, Austin CA.
Digitoxín v koncentráciách bežne vyskytujúcich sa v plazme kardiakov antagonizuje aktivitu etopozidu a idarubicínu v leukemických bunkách K562.
Leuk Res. 2006, 30. júla (7): 895-8. Epub 2006, 4. januára.
PMID: 16387358 [PubMed – spracováva sa] ------

Lopez-Lazaro M, Pastor N, Azrak SS, Ayuso MJ, Austin CA, Cortes F.
Digitoxín inhibuje rast rakovinových bunkových línií v koncentráciách bežne vyskytujúcich sa u kardiakov.
J Nat Prod. 2005 Nov68(11):1642-5.
PMID: 16309315 [PubMed - indexované pre MEDLINE]

Cort & eacutes Benavides, Felipe
La naturaleza del ADN. Determinovaná nesprávna segregácia a chromozómové en mitózy
Investigación y Ciencia, Junio ​​2005, str. 35-36. ------

Mateos S, Domínguez I, Pastor N, Cantero G, Cortes F.
DNA demetylačná 5-azaC indukuje endoreduplikáciu v kultivovaných bunkách čínskeho škrečka.
Mutat Res. október 2005 15578 (1-2):33-42. Epub 23. marca 2005
PMID: 16202795 [PubMed - indexované pre MEDLINE]] ------

Hajji N, Mateos S, Pastor N, Dominguez I, Cortes F.
Indukcia genotoxického a cytotoxického poškodenia aklarubicínom, duálnym inhibítorom topoizomerázy.
Mutat Res. 2005 máj 2583 (1): 26-35.
PMID: 15866463 [PubMed - indexované pre MEDLINE] ------

Pastor N, Cantero G, Campanella C, Cortes F.
Endoreduplikácia indukovaná v kultivovaných bunkách čínskeho škrečka rôznymi chemikáliami proti topoizomeráze II. Dôkaz o zásadnom príspevku enzýmu k segregácii chromozómov.
Mutat Res. Apríl 4582 (1-2): 11-9. Epub 2005 24. januára.
PMID: 15781205 [PubMed-indexované pre MEDLINE] ------

Cortes F, Mateos S, Pastor N, Dominguez I.
K komplexnému modelu indukovanej endoreduplikácie.
Life Sci. 2004 nov 2676 (2): 121-35. Preskúmanie.
PMID: 15519359 [PubMed-indexované pre MEDLINE] ------

Hajji N, Pastor N, Mateos S, Dominguez I, Cortes F.
Prerušenia reťazca DNA indukované bis-dioxopiperazínom ICRF-193 proti topoizomeráze II.
Mutat Res. 2003 september 29530 (1-2): 35-46.
PMID: 14563529 [PubMed-indexované pre MEDLINE] ------

Cortes F, Pastor N, Mateos S, Dominguez I.
Povaha DNA hrá úlohu pri segregácii chromozómov: endoreduplikácia v halogénom substituovaných chromozómoch.
Oprava DNA (Amst). 2003 Jun 112 (6): 719-26.
PMID: 12767350 [PubMed - indexované pre MEDLINE] ------

Pastor N, Jose Flores M., Dominguez I., Mateos S., Cortes F.
Vysoký výťažok endoreduplikácie indukovanej ICRF-193: katalytický inhibítor topoizomerázy II.
Mutat Res. 2002 apríl 26516 (1-2):113-20.
PMID: 11943617 [PubMed - indexované pre MEDLINE] ------

Pastor N, Dominguez I., Mateos S., Cortes F.
Porovnávacia štúdia genotoxických účinkov liekov proti topoizomeráze II ICRF-193 a bufalínu na bunky vaječníkov čínskeho škrečka.
Mutat Res. 2002, marec 25515 (1-2): 171-80.
PMID: 11909765 [PubMed - indexované pre MEDLINE] ------

Dominguez I, Pastor N, Mateos S, Cortes F.
Testovanie mechanizmu SCE s nejedovatými inhibítormi topoizomerázy II.
Mutat Res. 2001 okt 18497 (1-2):71-9.
PMID: 11525909 [PubMed - indexované pre MEDLINE] ------

Dominguez I., Mateos S., Cortes F.
Súvisiace články, odkazy
Výťažok SCE a translokácie produkované 3 aminobenzamidom v kultivovaných bunkách čínskeho škrečka.
Mutat Res. 2000 Mar 14448 (1): 29-34.
PMID: 10751620 [PubMed - indexované pre MEDLINE] ------


2.6: Endoreduplikácia - biológia

Endoreduplikácia, je špeciálny typ tkanivovo špecifickej amplifikácie genómu, ktorá sa vyskytuje v mnohých typoch rastlinných buniek a v špecializovaných bunkách niektorých zvierat vrátane ľudí. Endoreduplikácia neovplyvňuje zárodočnú líniu ani gaméty, takže druhy s endoreduplikáciou nie sú považované za polyploidy. Endoreduplikácia nastáva, keď bunka podstúpi ďalšie kolá syntézy DNA (fáza S) bez akejkoľvek mitózy alebo cytokinézy, aby sa vytvorila endopolyploidná bunka. To produkuje viac chromatidov každého chromozómu. Zdá sa, že endopolyploidia je spojená s bunkami, ktoré sú metabolicky veľmi aktívne a produkujú veľa enzýmov a iných proteínov v krátkom časovom období. Príkladom je vysoko endoreduplikovaná slinná žľaza polytén chromozómov D. melanogaster (Obrázok 2.17), ktorý môže mať viac ako 1 000 chromatidov, ktoré sa navzájom zarovnávajú a vytvárajú jedinečný pruhovací vzor, ​​ktorý odráža sekvenciu DNA a gény v tejto chromozómovej oblasti. Tieto chromozómy boli užitočnými výskumnými modelmi v genetike, pretože ich relatívne veľká veľkosť uľahčuje identifikáciu a štúdium chromozómových aberácií pod mikroskopom.

Softvér CuboCube je otvorený zdroj. Zdrojový kód je dostupný v našom verejnom úložisku Github.


Abstrakt

Výsledky pre väčšinu pacientov s myelómom sa za posledné desaťročia zlepšili vďaka pokroku v liečbe. Existuje však podskupina pacientov, u ktorých sa predpokladá, že majú vysokorizikové ochorenie, a ktorí z toho nemali prospech. Pochopenie toho, ako sa vysokorizikové ochorenie vyvíja z terapeuticky prístupnejších štádií, je kľúčové, ak chceme zlepšiť výsledky. To sa dá dosiahnuť identifikáciou genetických mechanizmov a mutácií, ktoré vedú k prechodu normálnej plazmatickej bunky k bunke s charakteristikami nasledujúcich štádií ochorenia: monoklonálna gamapatia neurčeného významu, tlejúci myelóm, myelóm a leukémia plazmatických buniek. Aj keď sú iniciačné udalosti myelómu klonálne, následné lézie vodiča sa často vyskytujú v subklone buniek, čo uľahčuje postup darwinovskými selekčnými procesmi. Pochopenie koevolúcie klonov v ich mikroprostredí bude rozhodujúce pre terapeutickú manipuláciu procesu. Konečným štádiom progresie je vytvorenie stavu spojeného s rezistenciou na liečbu, zvýšenou proliferáciou, únikom apoptózy a schopnosťou rásť nezávisle od mikroprostredia kostnej drene. V tomto prehľade diskutujeme o týchto konečných štádiách vysokorizikových chorobných stavov a o tom, ako nové informácie zlepšujú naše chápanie ich evolučných trajektórií, ako ich možno diagnostikovať a biologické správanie, ktoré je potrebné riešiť, ak sa s nimi má účinne liečiť.


3. Kedy boli objavené JA a ako bola stanovená ich úloha ako hormónov?

V roku 1899 Hesse a Müller vyčistili neznámy ketón Jasminum grandiflorum extrakty esenciálnych olejov a nazvali ho jazmón [13]. Jeho chemickú štruktúru vyriešili v roku 1933 Ruzička a Pfeiffer [14]. Purifikovaný jazmón v kombinácii s inými známymi zlúčeninami bol však tiež izolovaný z jazmín éterický olej, nemal charakteristickú vôňu jazmínových kvetov, čo naznačuje, že chýba jedna alebo viac zložiek. V roku 1962 bol nakoniec izolovaný metyljasmonát a bola určená jeho štruktúra a ukázalo sa, že ide o chýbajúcu molekulu odorantu [15]. Trvalo ďalších 20 rokov, kým biológovia zistili, že JA majú účinky na starnutie listov a rast sadeníc [16, 17]. Identifikácia biosyntetickej dráhy JA bola takmer dokončená už v roku 1992 [18], kým prvý A. thaliana Mutant odolný voči JA, coi1 (pre CORONATINE INSENSITIVE 1), bol izolovaný v roku 1994 [19]. Gén bol klonovaný v roku 1998 [20] a formálne identifikovaný ako jediný (zatiaľ) JA receptor o 11 rokov neskôr [21, 22].


Materiály a metódy

Inaktivácia lokusu XRCC3 v HCT116

Gény liekovej rezistencie bez promótora boli vložené do Exónu 3 v rámci. 1,5 kb 5 'zameriavací prvok bol amplifikovaný z izogénnej DNA buniek HCT116 pomocou I1-1 (5'-TGCGAGGTTCATACTCC-3') a E3-2A (5'-GCATCGATGCAAATCCATTATTTTGTCGG-3 '). 3,0 kb 3 'zameriavací prvok bol amplifikovaný pomocou E3-1 (5'-TACTGGACCTGAATCCCAGA-3') a I4-1 (5'-ATGGAAACCTTGTCCGTCCA-3 '). Oba prvky boli klonované do pCR2.1 (Invitrogen) klonovacou metódou TA. 3 'prvok bol vyrezaný pomocou KpnTrávil som a subklonoval som do KpnI miesto vo vektore obsahujúcom 5′ element. Kazeta rezistencie na neomycín sa amplifikovala z pMC1neo-polyA (Stratagene) pomocou Cla4neol (5'-CTATCGATGTATGGGATCGGCCATT-3') a neo8cla2 (5'-TCATCGATGAAGCTTGGCTGCAGGT-3'). Kazeta odolná voči hygromycínu bola amplifikovaná z pcDNA/Hygro (Invitrogen) pomocou ClaI-hyg (5′-CTATCGATGTATGAAAAAGCCT-3 ′) a hyg-ClaI (5′-TCATCGATGAGGCTTTACACTTT-3 ′). Kazeta s rezistenciou na liečivo bola vložená do ClaI miesto vektora obsahujúceho oba prvky v rámci. Bola opísaná metóda knock -out experimentov v HCT116 (Miyagawa a kol, 2002). Anti-XRCC3 protilátka bola získaná od Chemicon.

Expresia génu XRCC3

Človek XRCC3 cDNA sa amplifikovali z cDNA pochádzajúcej z normálnej krvi s použitím E3-5 (5'-CCTCCCACAGGCTTTGAATT-3 ') a 3UTR-1 (5'-GAAGAGCTGTGTCTGAACCA-3'). CDNA sa vložili do pCR2.1 a sekvencia sa potvrdila. The XRCC3 cDNA boli vložené za MSV zosilňovač a MMTV promótor. XRCC3-deficientné bunky boli transfekované vektormi a selektované v prítomnosti 900 ug/ml Zeocínu (Invitrogen). Nadmerná expresia XRCC3 v bunkách nadmerne exprimujúcich RPA sa uskutočnila s použitím rovnakých vektorov a pKO SelectPuro (Lexicon Genetics), pretože bunky nadmerne exprimujúce RPA už boli transfekované génmi rezistencie na zeocín. Bunky nadmerne exprimujúce XRCC3 sa izolovali pomocou PCR s použitím primerov špecifických pre expresné vektory.

Rýchlosť rastu a citlivosť na činidlá poškodzujúce DNA

Na bunky sa pôsobilo MMC (Kyowa-Hakko) v suspenzii počas 10 minút, dvakrát sa premyli fyziologickým roztokom pufrovaným fosfátom (PBS) a naniesli sa na platne s hustotou 2 x 103 buniek na 60 mm misku. Po 7 dňoch kultivácie sa spočítali kolónie. Citlivosť na ionizujúce žiarenie a rýchlosť rastu sa merali tak, ako je opísané (Miyagawa a kol, 2002 ).

Meranie frekvencií homológnej rekombinácie a tvorby zaostrenia Rad51

Metódy merania úrovní SCE a cielenej frekvencie integrácie pri RAD54B lokusy boli popísané, a to pre RAD51C lokus bol upravený (Miyagawa a kol, 2002). Na zlepšenie frekvencie zacielenia na RAD51C lokusu boli 5' a 3' targetingové prvky amplifikované z izogénnej DNA. Formácia zaostrenia Rad51 sa skúmala, ako bolo popísané vyššie (Tashiro a kol, 2000 ).

RYBY analýza

Chromozómovo špecifické centromerické sondy boli získané od Vysis. DNA v bunkách bola denaturovaná v 70% formamide/2 x SSC pri 72 °C počas 1,5 minúty. Hybridizácia sa uskutočnila v CEP Hybridization Buffer (Vysis) pri 37 °C počas 48 hodín. Sklíčka sa dvakrát premyli v 50% formamide/2 x SSC pri 45 ° C po dobu 5 minút a dvakrát v SSC pri 45 ° C počas 5 minút dvakrát. Bunková DNA bola zafarbená DAPI.

Analýza bunkového cyklu

Na meranie mitotického indexu bol do kultivačného média pridaný nokodazol do konečnej koncentrácie 200 ng/ml. Bunky sa zozbierali v 6 hodinových časových intervaloch, fixovali v 70% etanole a farbili Hoechst 33258. Na meranie obsahu DNA sa bunky kultivované v prítomnosti 100 ng/ml nocodazolu odobrali v uvedených časových bodoch, trikrát sa premyli PBS. a fixovaný v 70 % etanole. Fixované bunky boli ošetrené 500 ug/ml RNázyA počas 30 minút pri 37 °C a bol pridaný propídiumjodid do konečnej koncentrácie 50 ug/ml. Prietoková cytometria sa uskutočnila s použitím FACS Caliber (Becton Dickinson).

Imunoprecipitácia

Bunkové extrakty boli pripravené v lyzačnom pufri (50 mM Tris-HCl, pH 7,5, 100 mM NaCl, 5 mM EDTA, pH 8,0, 0,5% Nonidet P-40, 1 mM PMSF, 20 μg/ml aprotinínu, 10 μg/ml leupeptínu (300 Kunitz U/ml DNáza I), inkubované 30 minút na ľade a lyžované ultrazvukom. Nerozpustný materiál sa odstránil vysokorýchlostnou centrifugáciou. Extrakt celých buniek bol vopred vyčistený normálnym myšacím IgG a 15 μl rekombinantnej proteín-G agarózy (Invitrogen). Vzorky sa inkubovali s protilátkami počas 1 hodiny pri 4 ° C. Ku každej vzorke sa pridalo 15 ul proteín-G agarózy a vzorky sa inkubovali 1 hodinu pri 4 °C a šesťkrát sa premyli premývacím pufrom (50 mM Tris-HCl, pH 7,5, 100 mM NaCl, 5 mM EDTA pH 8,0, 0,5 % Nonidet P-40, 1 mM PMSF). Komplexy boli vizualizované analýzou Western blot. Anti-RPA32 (12F3.3) a anti-RPA14 (11.1) protilátky boli získané od GeneTex. Protilátka Anit-RPA70 (C-21) bola získaná od Santa Cruz Biotechnology. Protilátka Anti-Rad51C bola získaná od spoločnosti Chemicon. Anti-XRCC3 (165-100) a anti-Rad52 (H-300) protilátky boli získané od Novus Biologicals a Santa Cruz Biotechnology, v danom poradí.

Prechodná expresia v bunkách COS7

The XRCC3 cDNA a RPA cDNA sa klonovali do pcDNA3.1 (Invitrogen). The RAD52 cDNA bola klonovaná do pcDNA3.1/Hygro. Plazmidy boli transfekované pomocou činidla Superfect Transfection Reagent (Qiagen) podľa pokynov výrobcu. Bunky kultivované 48 hodín po transfekcii sa zozbierali v lýzovom pufri.

Expresia RPA génov

Ľudské RPA cDNA boli amplifikované z cDNA odvodenej z normálnej krvi. Na amplifikáciu génov RPA boli použité nasledujúce priméry: 5 'sense primér RPA70 (5'-AAGTCTTGGCGGTGGAGCCA-3') RPA70 3 'antisense primer (5'-AAATCGATTCCATTCTGCC-3') RPA32 5 'sense primér (5'- TCGGCCTCTTTGCGGAGAAT-3 ') RPA32 3' antisense primer (5'-GATTGTGAAACTAGGTCC-3 ') RPA14 5' sense primer (5'-AGCCGCAGTCTTGGACCATA-3 ') RPA14 3' antisense primer (5'-AAGC. cDNA boli vložené do pCR2.1 a sekvencia bola potvrdená. RPA cDNA boli vložené downstream od MSV zosilňovača a MMTV promótora. Bunky HCT116 boli transfekované vektormi a vybrané v prítomnosti 900 ug/ml Zeocinu.

Expresia génov RAD52 a RAD51C

Človek RAD52 cDNA bola klonovaná z cDNA knižnice ľudských semenníkov (Clontech) a vložená za MSV zosilňovač a MMTV promótor. Bunky nadmerne exprimujúce RPA14 a XRCC3 -/ - bunky sa transfekovali vektormi obsahujúcimi gény rezistencie voči lieku a vybrali sa v prítomnosti 200 ug/ml hygromycínu, respektíve 900 ug/ml zeocínu. Mutant exprimujúci variantný proteín XRCC3 bol transfekovaný RAD52 expresný vektor a pKO SelectPuro, a boli vybrané v prítomnosti 1,25 μg/ml puromycínu, pretože mutantné bunky už boli transfekované génmi rezistencie na hygromycín a Zeocin. Mutantný nadmerne exprimujúci Rad52 bol izolovaný pomocou PCR s použitím primerov špecifických pre expresný vektor. Človek RAD51C cDNA bola amplifikovaná z cDNA odvodenej z normálnej krvi. cDNA bola vložená do rovnakého vektora a vložená do XRCC3 -/ - bunky. Selekcia sa uskutočnila v prítomnosti 900 ug/ml zeocínu.


Metódy

Všeobecné metódy a kmene

Kmene sa kultivovali pomocou štandardných metód [10] a udržiavali sa pri 20 ° C. Kmeň Bristol N2 bol použitý ako štandardný kmeň divokého typu vo všetkých experimentoch. Všetky kríženia sa uskutočnili podľa štandardných metód [37]. Použité mutantné alely sú uvedené nižšie podľa väzbovej skupiny (LG) a boli opísané v [10], pokiaľ nie je uvedené inak: (LGII): sma-6 (1482), (LGIII): dlho-1 (e185), (LGV): lon-8(hu187), dlho-8 (hu188), (táto štúdia), dlho-3 (e2175), dbl-1 (nk3) [16], ho-5(e1490), (LGX): dlho-2 (e678). V tejto štúdii boli použité nasledujúce transgénne línie: BW1940 ctIs40 [dbl-1xs] [17], JR667 je 51 [22], KN746 huEx96 (táto štúdia), KN905 huEx129 (táto štúdia).

Sekvenovanie z dĺžka-8

Na zosilnenie dlho-8 cDNA z kvasinkovej dvojhybridnej cDNA knižnice (dar M. Walhouta a M. Vidala) sme použili primér nasmerovaný na 5' stranu pPC86 polylinkera s dĺžka-8 primér CTGCAGAATTACTGACTGTTGGGATC a primer nasmerovaný na 3 'stranu pPC86 s dlho-8 primer CAGTCAGTAATTGCG-GATTTG. Všetky amplifikované produkty boli purifikované a sekvenované z oboch smerov, aby sa získala plná dĺžka dlho-8 sekvencia cDNA.

Ak chcete sekvenovať dlho-8 prepis prítomný v divokom type a hu187 zvierat sme použili 1 μg celkovej RNA z N2 a hu187 (pozri nižšie) na generovanie cDNA pomocou RT-PCR s použitím oligo-dT priméru. Potom sme zosilnili dlho-8 cDNA používajúce priméry pre sekvenciu SL1 a CTGCAGATTCCTCGCTTTCGCTG zodpovedajúce 3 'koncu štvrtého exónu dĺžka-8 a sekvenovali purifikované produkty z oboch smerov, aby sa získal divoký typ a hu187 cDNA sekvencie.

Izolácia a charakterizácia dĺžka-8alely

Deléčné alely dlho-8 (hu187) a dlho-8 (hu188) boli generované konštrukciou a skríningom delečnej knižnice, ako je opísané v [38]. Priméry použité na identifikáciu a sekvenovanie hu187 delečné alely boli TGCAATAGGTGTACGAAAAG a CCACAACACATACATTCCAT ako externý pár a GAGTGGAATGCTAATAGGGA a GTGAAGCAGCGTATCAACTA ako vnútorný pár. Priméry používané na identifikáciu a sekvenovanie hu188 deléčné alely boli TTTTCTTTGAGCCGCAAAAT a CAGGTAACGCCATGAGGAAT ako externý pár a CAAAGGAGGTCGAAAGTGGA a CCATTCTGGCAGTGATCTCC ako vnútorný pár.

Merania veľkosti tela

Kmene sa synchronizovali jemným prepláchnutím 9 cm doštičiek populácie zmiešaného štádia, aby sa odstránili všetky dospelé jedince a larvy, pričom nevyliahnuté vajíčka zostali. O hodinu neskôr sa platne jemne opláchnu, aby sa zhromaždili larvy vyliahnuté v tomto intervale. Pre rastovú krivku boli synchronizované zvieratá držané pri 20 ° C a na meranie v každom časovom bode bola použitá jedna platňa z každého kmeňa. Zakaždým sa odobrali vzorky z minimálne 75 náhodných zvierat. Na epistatickú analýzu sa použila kontrola N2 spolu s každou synchronizáciou, aby sa zaistili konzistentné výsledky, pretože veľkosť tela sa môže líšiť v dôsledku vonkajších podmienok, ako je vlhkosť [11]. Na meranie sa zvieratá namontovali na 2% agarózové sklíčka obsahujúce 10 mM azidu sodného a ihneď sa fotografovali pri 33,5 -násobnom zväčšení pomocou mikroskopu Zeiss Axioplan2 a pripojeného digitálneho fotoaparátu Axiovision. Dĺžka tela bola určená pomocou softvéru Object Image 2.13. Dáta sa analyzovali pomocou GraphPad Prism.

Lon-8p::gfpfúzne konštrukty

Na vygenerovanie súboru Plon-8::gfp fúzny konštrukt pGS25, sekvencia zodpovedajúca 2 kb upstream oblasti až po druhý exón predpovedaného dlho-8 transkript bol amplifikovaný z genómovej DNA N2 pomocou primerov (PstI)-CTGACCGTAGAGCTTCC a (PstI)-CAAAATCCGCAATTACTGACTG. Tento fragment bol klonovaný do inzerčného vektora pPD95.69 GFP (A. Fire, osobná komunikácia) pomocou PstKlonujem stránku. Na generovanie konštruktu s vylúčením predpovedaného signálneho peptidu pGS26 boli z pGS25 amplifikované dva fragmenty: klonované dĺžka-8 protismerná sekvencia až po predpovedanú ATG pomocou reverzného priméru (BglII)-ATTCCTCATGGCGTTAC a fragment pozostávajúci z konca prvého exónu až po začiatok druhého exónu s použitím dopredného priméru (BglII) -AGTGAGTTGTTTAC. Štiepené fragmenty sa súčasne ligujú do pPD95,69 s použitím PstKlonujem stránku.

Oba fúzne konštrukty boli injikované v koncentrácii 50 ng/μl do dpy-20 (e1282) a N2 zvieratá s použitím 50 ng/ul pMH86 (obsahujúceho divoký typ dpy-20) alebo 20 ng/μl pPY20 (P.T. Yang, osobná komunikácia) ako markery spoločnej injekcie. pPY20 (Pmyo-2 :: paradajka) exprimuje červený fluorescenčný paradajkový proteín [39] v hltane. Vytvorilo sa niekoľko riadkov, ktoré vykazovali podobné vzorce expresie. huEx96 a huEx129 boli vybraní na ďalšiu analýzu.

Northern bloty

Celková RNA sa zhromaždila z populácií v zmiešanom štádiu N2, lon-8(hu187), lon-8(hu188), dlho-1 (e185), ctIs40 [dbl-1xs], dbl-1 (nk3) a sma-6(e1482). Zvieratá sa lýzovali počas 5 minút pri 60 °C v pufri obsahujúcom 2 mg/ml proteinázy K. RNA sa izolovala použitím Trizol LS (Invitrogen), nasledovala extrakcia chloroformom a zrážanie izopropanolom. 10 ug celkovej RNA sa vložilo do každého pruhu 6% formaldehydového gélu. Po elektroforéze sa RNA preniesla na membránu Bio-Rad Zeta-Probe. The dlho-8 sonda bola vytvorená zosilnením dĺžka-8 transkript z knižnice cDNA pomocou primerov CCCGGGCATGAGGAATTCGCGGTT a CCCGGGTATGATATGGAATTATCG. The dlho-1 Sonda bola vytvorená amplifikáciou 250 bp fragmentu exónu 6 z N2 genómovej DNA s použitím primérov GATGCCAGCTTTCACCTG a CTCTCATTCGGAACCCGTC. The ľavý-2 Sonda bola vytvorená amplifikáciou 400 bp fragmentu exónu 4 z N2 genómovej DNA s použitím primérov GCACAATCGTCTTCACTGTACC a GTAAGAACCGAAGCGTAGAAC.

Endoreduplikačné meranie

Synchronizovali sme populácie N2, dlho-1 (e185)a dlho-8 (hu187) ako je popísané vyššie. Po 120 hodinách sa zvieratá zozbierali a fixovali cez noc v Carnoyovom roztoku. Zvieratá boli potom zafarbené DAPI a analyzované podľa popisu [2], alebo zafarbené PI a bezprostredne analyzované konfokálnou mikroskopiou, ako je opísané [23]. Pre každé zviera sme vyrobili jeden konfokálny stoh chvostovej oblasti medzi jadrami švových buniek V5.ppppp a V6.ppppp. Obsah DNA všetkých hypodermálnych jadier umiestnených medzi týmito ševovými bunkami (8 jadier na zviera) sa meral ako je definované súčtom intenzity PI. Potom sme toto číslo rozdelili priemerom intenzity PI najmenej štyroch neuronálnych jadier ventrálneho nervového kordu z rovnakého konfokálneho zväzku, aby sme získali priemerný pomer obsahu hypodermálnej a neuronálnej DNA pre každé zviera.

Experimenty RNAi

Bakteriálne klony exprimujúce dsRNA vybraných génov boli vybraté z knižnice RNAi laboratória Ahringer Lab [40]. Päťdesiat divokého typu alebo lon-8(hu187) Larvy L4 sa umiestnili na platne obsahujúce prázdny vektor, dĺžka-8, dpy-11 alebo dpy-18 dsRNA exprimujúce baktérie, pestované cez noc pri 15 ° C a prenesené na čerstvé RNAi platne. Populácie sa synchronizovali odstránením zvierat po 7 hodinách, pričom sa ponechalo nevyliahnuté potomstvo. Tieto zvieratá boli pestované pri 15 °C počas 190 hodín, čo je ekvivalent 120 hodín rastu pri 20 °C [41], potom boli odobraté a zmerané, ako je opísané vyššie.


Možnosti prístupu

Získajte plný prístup k denníku na 1 rok

Všetky ceny sú ceny NET.
DPH bude pripočítaná neskôr pri pokladni.
Výpočet dane bude dokončený pri pokladni.

Získajte na ReadCube časovo obmedzený alebo úplný prístup k článkom.

Všetky ceny sú ceny NET.


Synopsa

Hlboké profilovanie transkriptómu a proteómu počas vývoja listov odhaľuje neočakávané reakcie na nedostatok vody, ako aj prekvapivý nedostatok fluktuácií na úrovni proteínov počas cyklu deň-noc, napriek jasným zmenám na úrovni transkriptu.

  • Vzory variácií transkriptu a proteínu odrážajú funkčné fázy listu.
  • Úrovne bielkovín a transkriptov počas vývoja listov dobre korelujú, až na niektoré významné výnimky.
  • Kolísaniu denného transkriptu neodpovedajú zodpovedajúce denné fluktuácie v detekovanom proteóme.
  • Nepretržitý znížený obsah vody v pôde má za následok obmedzený rast listov, ale rastlina sa prispôsobuje na molekulárnych úrovniach bez toho, aby vykazovala typickú reakciu na sucho.

Metódy

Identifikácia SMR gény v kukurici

Na identifikáciu SMR génov v referenčnom genóme B73 (RefGen_v4), použili sme uvedené Arabidopsis Sekvencie aminokyselín SIM/SMR [48] ako dotazy pri vyhľadávaní BLASTP proti všetkým kukuričným proteínom stiahnutým z databázy Phytozome s použitím e-hodnoty 1e-5 a identity 50% ako prahových hodnôt. Kľúčové slová „kukurica SIM“ a „kukurica SMR“ boli použité ako dotazy na vyhľadávanie v databáze bielkovín NCBI. Prístupy BLASTP a vyhľadávanie v databáze boli porovnané a analyzované ručnou úpravou. Ďalej sa vykonal BLASTN vlastného genómu v maizeGDB, aby sa našli možné chýbajúce génové modely. Tiež sa uskutočnil vlastný BLAST týchto sekvencií na odstránenie nadbytočných sekvencií a potom sa zostávajúce sekvencie predložili na webový server NCBI-CDD, aby sa potvrdila prítomnosť a integrita konzervovaných domén. Po ručnej korekcii boli získané predpokladané proteíny ZmSMR. Potom sa na určenie fyzikálno-chemických parametrov a subcelulárnej lokalizácie použili nástroj Expasy ProtParam (https://web.expasy.org/protparam/) a Softberry-ProtComp verzia 9.0 (http://www.softberry.com/berry.phtml). kukuričných proteínov SMR, resp.

Regulačné prvky v promótorovej oblasti ZmSMR

1,5-kb DNA sekvencia upstream od iniciačného kodónu (ATG) každého z nich ZmSMR bol stiahnutý z databázy Phytozome [53]. Miesto začiatku transkripcie bolo označené ako + 1. Prvky v promótorových fragmentoch (od -1500 bp do + 1 bp) ZmSMR gény boli identifikované pomocou zariadenia PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) [53, 54], PlantPan 2.0 (http://plantpan2.itps.ncku.edu.tw) [ 55] a Databáza regulačných prvkov rastlín RegSite - online program Softberry (http://www.softberry.com/berry.phtml) [56, 57].

Identifikácia syntenických génov

Syntenické vzťahy génov kukurice boli identifikované porovnaním sekvencií genómu kukurice B73 pomocou utility SynMap [58] webovej stránky CoGe (https://genomevolution.org/coge/). Syntenické gény boli detegované pomocou údajov CDS s predvolenými nastaveniami okrem algoritmu Quota Align Merge a konečný výstup syntenického génového súboru s odkazmi GEvo bol stiahnutý na ďalšiu analýzu [59].

Fylogenetická analýza a analýza konzervovaných motívov

Viacnásobné zarovnanie sekvencií proteínových sekvencií ZmSMR s plnou dĺžkou sa uskutočnilo pomocou ClustalW ako integrovanej do MEGA 7.0 s predvolenými parametrami. Fylogenetická rekonštrukcia bola vykonaná pomocou MEGA 6.0 pomocou metódy Neighbor-joining s 1 000 replikátov bootstrapu [60]. Študovať fylogenetický vzťah proteínov SMR v Z. mays, A. thaliana, O. sativa, S. bicolor, S. italica, B. distachyon, G. max, P. trichocarpa a P. patens, sekvencie SMR aa v plnej dĺžke boli získané z databáz NCBI a Phytozome. Okrem toho sa pre tieto získané gény vykonal BLAST vlastného genómu, aby sa našli možné chýbajúce génové modely. Vykonalo sa zarovnanie viacerých sekvencií a nekoreňovaný strom sa vykreslil tak, ako bolo opísané vyššie. Okrem toho sa na ďalšie skúmanie rozmanitosti kompozícií motívov v domnelých proteínoch ZmSMR použila na predpovedanie konzervovaných motívov v týchto proteínoch maximalizácia viacnásobného očakávania pre online vyhľadávací softvér [MEME] [61]. Maximálny počet motívov bol stanovený na šesť [62].

Odber vzoriek semien pri rôznych rýchlostiach plnenia DAP a zrna

kukurica (Z. mays L.) inbrednú líniu B73 poskytlo Kľúčové laboratórium biológie a genetického zlepšenia kukurice v suchých oblastiach severozápadného regiónu, ministerstvo poľnohospodárstva, Vysoká škola agronomická, Northwest A & ampF University. Linky boli dopestované na poli v lete 2012 v Yanglingu, Shaanxi, Čína. Uši sa samoopelili v ten istý deň. Semenný endosperm v rovnakej polohe v kukuričných klasoch sa zbieral každých 5 dní od 0 do 30 DAP (5 DAP pre celé semená), zmrazil sa v tekutom dusíku a potom sa uložil do mrazničky pri -80 ° C. RNA sa izolovala z časti semien a použila sa na testovanie relatívnej expresie SMR gény počas vývoja endospermu kukurice. Ostatné semená sa udržiavali pri 105 ° C počas pol hodiny, aby sa deaktivovali, a potom sa sušili na konštantnú hmotnosť pri 80 ° C. Rýchlosť plnenia zrna bola vypočítaná vydelením prírastku hmotnosti sto zŕn počtom dní a zŕn medzi dva susediace stupne plnenia zŕn [16]. Pri analýze qRT-PCR sa uskutočnili tri biologické replikáty.

Podmienky rastu rastlín a liečba stresu

Semená kukuričnej inbrednej línie B73 boli ponorené do 10% H2O2 na 30 minút na dezinfekciu a potom boli ošetrené 3% CaS03 počas 3 hodín, aby sa podporilo klíčenie. Ošetrené semená sa pestujú v Hoaglandovom roztoku v skleníku pri 14-hodinovom cykle svetla a 10 hodín tme pri 23 ± 1 ° C. Leaves were collected from maize seedlings at the three-leaf stage and were then used in the expression profiling of ZmSMR genes under ABA, heat, cold, salt, and drought stresses. For heat and cold stress, the maize seedlings were placed in 42 °C and 4 °C environments, respectively. The maize seedlings were immersed in a 100 μM ABA solution for hormone treatment. For these three stresses, the leaves from the seedlings were collected after 2, 6, 12, and 24 h. The solutions for salt and drought treatments were prepared by adding NaCl (200 Mm/L) and PEG [20% (m/v)] to full-strength Hoagland’s solution, respectively. Both treatments lasted 12 h, 24 h, 48 h, and 72 h. Control check (CK) seedlings were kept in the unstressed growth conditions. Three biological replicates were performed in the qRT-PCR analysis.

RNA isolation and quantitative real-time PCR

Total RNA was extracted using the TaKaRa MiniBEST Plant RNA Extraction Kit (Takara, Dalian, China). RNase-free DNase-I was used to remove any contaminating genomic DNA in the solution. First-strand cDNA synthesis was conducted using a FastQuant RT Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions. The qRT-PCR analysis of all 12 ZmSMRs was performed using primers that were designed according to the ZmSMRs’ sequences and using an NCBI Primer-BLAST online instrument (Additional file 11). The amplification products were controlled within a size range of 130 bp to 250 bp (Additional file 11). The maize actin (Zm00001d013873) gene was used as an internal control. All primers were synthesized by Sangon Biotech Company. The qRT-PCR assays were performed in optical 96-well plates with three technical replicates using the BIO-RAD CFX96 Detection System (Bio-Rad, CA, USA). Each reaction was performed in 20 μL of a SuperReal Premix Plus (SYBR Green) reaction mixture (TIANGEN, Beijing, China), following the manufacturer’s instructions. The relative expression ratio of each gene was calculated using the 2 - △ △ CT method [63].