Informácie

Prekonanie inbreedingovej depresie

Prekonanie inbreedingovej depresie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Keď dôjde k depresii z príbuzenského kríženia, geneticky nepríbuzný jedinec sa spári so zvieraťom, aby sa zaviedla genetická variabilita a odstránila homozygotnosť. V tomto prípade sa môže uskutočniť buď kríženie alebo kríženie. Uprednostňuje sa niektorá z techník pred ostatnými? Out-chov tu označuje párenie dvoch jedincov rovnakého plemena, ale žiadnych nedávnych spoločných predkov. Krížový chov sa týka úplného párenia dvoch jedincov rôznych plemien.


Inbreedingovú depresiu je možné prekonať nasledujúcimi spôsobmi: 1. Chov mimo- chov zvierat, ktoré navzájom nesúvisia a nemajú predkov po dobu 4 až 6 generácií. 2. Prekríženie sa vykonáva so zvieratami rovnakého plemena, ale po 4-6 generáciách 3. kríženie- lepší samec spojený s nadradenou samicou iného plemena 4. medzidruhové hybridizácie- samec a samica dvoch rôznych príbuzných druhov


Genetický základ inbreedingovej depresie u zemiakov

Inbrídingová depresia spôsobuje zníženú kondíciu medzi potomkami genetických príbuzných. Zemiaky (Solanum tuberosum L.) ako klonálne množená plodina trpia vážnou inbreedingovou depresiou, avšak genetický základ inbreedingovej depresie v zemiakoch je do značnej miery neznámy. Aby sme získali prehľad o inbreedingovej depresii v zemiakoch, vyhodnotili sme mutačnú záťaž v 151 diploidných zemiakoch a získali sme 344 831 predpovedaných škodlivých substitúcií. Škodlivé mutácie v zemiakoch sú obohatené o pericentromerické oblasti a sú špecifické pre líniu. Pomocou troch F.2 populácií sme identifikovali 15 genómových oblastí so závažnými segregačnými deformáciami v dôsledku selekcie v herných a zygotických štádiách. Väčšina škodlivých recesívnych alel ovplyvňujúcich prežitie a dynamiku rastu bola umiestnená v oblastiach s vysokou mierou rekombinácie. Jedna z týchto škodlivých alel je odvodená od vzácnej mutácie, ktorá narúša gén potrebný na vývoj embrya. Táto štúdia poskytuje základ pre návrh genómu zemiakových inbredných línií.


Prekonanie inbrídingovej depresie – biológia

V malej populácii je bežné párenie medzi príbuznými. Toto príbuzenské kríženie môže znížiť schopnosť populácie prežiť a rozmnožovať sa, čo je fenomén nazývaný depresia príbuzenského kríženia. Napríklad populácia 40 doplnkov (Vipera berus, znázornené vpravo), zažili depresiu príbuzenského kríženia, keď ich poľnohospodárske činnosti vo Švédsku izolovali od ostatných populácií. V izolovanej populácii sa narodilo vyššie množstvo mŕtvo narodených a zdeformovaných potomkov ako vo väčších populáciách. Keď vedci predstavili prídavné látky z iných populácií a#151 príklad outbreedingu, izolovaná populácia sa zotavila a vytvorila vyšší podiel životaschopných potomkov.

Vysvetlenie inbreedingovej depresie spočíva v evolučnej histórii populácie. Postupom času prirodzený výber vylúči škodlivé alely z populácie, a keď sa prejavia dominantné škodlivé alely, zníži sa zdatnosť nosiča a v ďalšej generácii sa vytvorí menej kópií. Ale recesívne škodlivé alely sú „ukryté“ pred prirodzeným výberom svojimi dominantnými neškodnými náprotivkami. Jedinec nesúci jednu recesívnu škodlivú alelu bude zdravý a môže ľahko preniesť škodlivú alelu do ďalšej generácie.

Keď je populácia veľká, vo všeobecnosti to nie je problém & populácia môže niesť veľa recesívnych škodlivých alel, ale zriedkavo sa prejavujú. Keď sa však populácia zmenší, blízki príbuzní sa nakoniec pária a títo príbuzní ich pravdepodobne nosia rovnaký recesívne škodlivé alely. Keď sa príbuzní spária, potomstvo môže zdediť dva kópie tej istej recesívnej škodlivej alely a znášajú dôsledky vyjadrenia škodlivej alely, ako je to znázornené na nasledujúcom príklade. V prípade švédskych prídavkov to znamenalo mŕtve potomstvo a deformácie.

V prípade švédskych aderov bolo riešenie problému inbreedingovej depresie jednoduché a zadajte prídavky z iných populácií. Ak však vombat chlpatý severný trpí depresiou z príbuzenského kríženia, neexistujú žiadne iné populácie, ktoré by ho mohli zachrániť. Pochopenie evolučnej histórie populácie a pravdepodobnosti, že nesie recesívne škodlivé alely, naznačuje, že by sme nemali dovoliť, aby veľkosť populácie klesla príliš nízko v našom úsilí o ochranu, pretože inbrídna depresia môže ohroziť prežitie druhu.


Negatívne aspekty chovateľskej praxe

Nihar Ranjan Chattopadhyay, v indukovanom chove rýb, 2017

5.3.12 Lokálne vymieranie v prítomnosti migrácie

Inbrídingová depresia je normálne redukovaná prisťahovalcami, ktorí sú heterozygotní pre škodlivé recesívne mutácie (Whitlock et al., 2000), a heterózou sa môže zvýšiť priemerná zdatnosť populácií. Outcrossing však môže znížiť priemernú populačnú zdatnosť, ak hybridizácia naruší komplementárne génové komplexy alebo priaznivé epistatické interakcie (prekonanie depresie). Len málo štúdií preukázalo outbreeding depresie, pretože si vyžaduje sledovanie F1 generácia. Štúdia vrabcov spevných (Marr et al., 2002), ukázala známky outbreedingovej depresie v F2 generácie, a miery kondície boli nízke v F2. generácia krížov kopepoda tidepool (Tigriopus californium) z rôznych populácií (Burton, 1990). Tento efekt rozpadu koadaptácií je však zosilnený iba vtedy, ak sa genetická vzdialenosť medzi týmito dvoma populáciami výrazne zvýšila (Edmands, 1999). Hrozba premnoženia teda nemusí byť vo väčšine divokých populácií veľmi vážna, pretože trvá mnoho generácií v kontrastných prostrediach, kým sa genetická vzdialenosť výrazne zväčší.

Zníženie alebo zvýšenie kondície v populácii po prijatí imigrantov závisí aj od interakcií medzi niekoľkými genetickými a negenetickými faktormi (stupeň epistázy, demografia, správanie, životné prostredie atď. Tallmon a kol., 2004). Preto môže byť ťažké predpovedať, či nejaká daná imigračná udalosť ovplyvní genetickú záchranu, najmä keď manažéri ochrany prírody nechápu interakcie medzi genetickými a negenetickými faktormi. Gaggiotti (2003) však zhodnotil štúdie o rastlinách ako napr Lotus scoparius, Ipomopsis aggregataa Silene diclinis a dospel k záveru, že depresia outbreedingu môže byť v prírode bežná, ale potenciálne výhody outbreedingu väčšinou prevažujú nad hrozbami outbreedingovej depresie.


FĽAŠE

Všetky odporúčania, ktoré boli uvedené v predchádzajúcej časti, boli založené na udržiavaní minimálnej konštanty Ne's. Bohužiaľ je ťažké udržať konštantný Ne generácia po generácii. Každý, kto niekedy spravoval populáciu rýb, príliš dobre vie, že je ťažké udržať populáciu v ustálenom stave. Mnoho faktorov sprisaháva príležitostne zníženie veľkosti populácie. Náhle drastické zníženie veľkosti populácie sa nazýva & ldquobottlenecks. & Rdquo Genetické efekty úzkych miest môžu byť zničujúce a môžu mať dlhodobé dôsledky.

Ako bolo opísané v kapitole 4, priemerný Ne za sériu generácií je harmonický priemer, nie jednoduchý aritmetický priemer. V dôsledku toho generácia s najmenším Ne má neúmerný vplyv na priemernú hodnotu. To znamená, že úzke miesto môže dramaticky znížiť priemerný Ne, čo následne dramaticky zvýši kríženie a genetický drift.

Napríklad, ak chce farmár udržiavať konštantný Ne zo 100 na 10 generácií, ale má úzke miesto v 20. generácii 6, priemerný N.e ktorý vyrobil, je:

N.myslím možno určiť pomocou tlačidla &ldquo1/x&rdquo na ručnej kalkulačke.

Aritmetický priemer pre túto sériu Ne's je 92, takže znamená Ne je o 22 % menšia, ako by sa očakávalo. Ak by boli dve úzke miesta po 20, znamená to Ne by klesol len na 55,6.

Úzke miesta môžu mať vážne a dlhotrvajúce účinky na príbuzenskú plemenitbu, pretože akonáhle dôjde k príbuzenskej plemenitbe, zníži sa tým budúce Ne's, ako bolo popísané v kapitole 4. Vplyv, ktorý majú úzke miesta v priemernom príbuzenskom krížení, závisí od veľkosti úzkeho miesta a jeho počtu. Populácia, ktorá je nedostatočne riadená a ktorá má viacero úzkych miest, kde je populácia zredukovaná na relatívne málo samcov a/alebo samíc, bude celkom inbredná. Na druhej strane, dobre riadená populácia, ktorá má jediné úzke miesto, bude oveľa menej ovplyvnená. Jediné úzke miesto spôsobí okamžitý nárast inbreedingu a priemerný inbreeding sa môže zvýšiť o jednu alebo dve generácie (množstvo závisí od veľkosti úzkeho miesta), ale ak je populácia správne riadená tak, aby minimalizovala inbreeding pred a po úzkom mieste, priemerný inbreeding sa ustáli niekoľko generácií po úzkom mieste a škody spôsobené inbreedingom nemusia byť závažné.

Obrázok 32. Účinky úzkych miest na frekvenciu génov. Pretože genetický drift a pravdepodobnosť straty alel nepriamo súvisia s efektívnym počtom chovov (Ne), veľkosť úzkeho miesta určuje množstvo genetických zmien. Frekvencie A a a alely v populácii sú po 0,5. Ako úzke miesto (Ne) sa zmenšuje, genetický drift mení frekvenciu génu, až kým v extrémnom prípade frekvencia alely neklesne na nulu.

Účinky, ktoré môžu mať úzke miesta na genetický drift, sú oveľa ničivejšie. Pravdepodobnosť straty alely nepriamo súvisí s N.e, takže pravdepodobnosť straty alely sa zvyšuje, pretože Ne klesá. Úzke miesta dramaticky zvyšujú pravdepodobnosť. Účinok, ktorý môže mať úzke miesto na frekvenciu génov, je znázornený na obrázku 32.

Napríklad, ak sa farmár pokúša udržať konštantný Ne z 344 na 10 generácií, aby sa vytvorila záruka 99% na zachovanie alely, ktorej frekvencia je 0,01 (tabuľka 5) a pri generácii 8 je prekážka 25, pravdepodobnosť straty alely pri produkcii 10. generácie je určuje sa takto:

Krok 1. Musí sa určiť pravdepodobnosť straty alely v každej generácii.

Krok 2. Musí sa určiť záruka zachovania alely každej generácie (1,0 - pravdepodobnosť straty alely).

Pravdepodobnosť straty alely a záruky zachovania alely pre všetkých 10 generácií sú:

N.eKrok 1: Pravdepodobnosť straty alelyKrok 2: Záruka zachovania alely
(P = (1,0 - q) 2Ne )(1,0 – P)
344 P = (0,99) 2 (344) = 0.00099314770.999006852
344 P = (0,99) 2 (344) = 0.00099314770.999006852
344 P = (0,99) 2 (344) = 0.00099314770.999006852
344 P = (0,99) 2 (344) = 0.00099314770.999006852
344 P = (0,99) 2 (344) = 0.00099314770.999006852
344 P = (0,99) 2 (344) = 0.00099314770.999006852
344 P = (0,99) 2 (344) = 0.00099314770.999006852
25 P = (0,99) 2 (25) = 0.6050060670.394993932
344 P = (0,99) 2 (344) = 0.00099314770.999006852
344 P = (0,99) 2 (344) = 0.00099314770.999006852

Krok 3. Musí sa určiť záruka zachovania alely po dobu 10 generácií. Je to výsledok záruky zachovania alely pre každú generáciu, t. J. Záruky pre každú generáciu sa vynásobia, aby sa určila záruka po vyrobení 10. generácie:

Záruka po 10 generáciách=(0.999006852)(0.999006852)(0.999006852)(0.999006852)
(0.999006852)(0.999006852)(0.999006852)(0.394993932)
(0.999006852)(0.999006852)
Záruka po 10 generáciách=0.3915

Krok 4. Musí sa určiť pravdepodobnosť straty alely po 10 generáciách. Je to 1,0 - záruka zachovania alely:

Pravdepodobnosť straty alely = 1,0 - Záruka zachovania alely

Pravdepodobnosť straty alely = 1,0 - 0,3915

Pravdepodobnosť straty alely = 0,6085

Úzke miesto 25 pri generácii 8 zvýšilo pravdepodobnosť straty alely v 10. generácii z 0,01 (čo bol cieľ) na 0,6085.

Celkový účinok jediného zúženého miesta na genetický drift je oveľa vážnejší, ako je to v prípade priemerného príbuzenského kríženia, a jeho výskyt môže zabrániť farmárovi alebo manažérovi liahní dosiahnuť svoje ciele, aj keď odviedol vynikajúcu prácu po mnoho generácií. Je to preto, že akonáhle je alela stratená, môže byť obnovená iba mutáciou alebo zavedením nového chovu. V dôsledku toho by prevencia úzkych miest mala byť hlavným cieľom manažmentu znášky, ak je genetickým cieľom minimalizácia škodlivých účinkov príbuzenského kríženia a genetického driftu.


Keď sa ohrozí voľne žijúca zver inbredná

Ohrozené populácie goríl nížinných sú v súčasnosti také malé, že tento druh čelí novej hrozbe: strate genetickej diverzity.

Gorily nemôžu chytiť prestávku. Populácia, sužovaná stratou biotopov, pytliactvom, politickou nestabilitou a inými hrozbami, prudko klesla. Niektoré izolované gorily nížinnej, teraz izolované v malých populáciách, čelia novej hrozbe: strate genetickej diverzity. Keď sa populácia zmenšuje, často sa zmenšuje aj genofond. Ak je pokles dostatočne závažný, príbuzenské kríženie môže dokonca ohroziť prežitie druhu.

Pokles schopnosti populácie prežiť prostredníctvom príbuzenského kríženia sa nazýva inbreedingová depresia. Ako však diskutovali biológovia Philip Hedrick a Steven Kalinowski v roku Ročné recenzie, inbreedingová depresia má za rôznych okolností rôzne podoby. Jeho vplyv na prežitie sa nedá ľahko zovšeobecniť. U druhov s dlhou životnosťou, ako sú gorily, sa môže celkový vplyv príbuzenského kríženia prejaviť až po desaťročiach a je ťažké ich študovať.

Inbreeding je často študovaný v laboratóriu s použitím organizmov ako Drosophila (ovocné mušky), kde je možné chovať a skúmať malú populáciu počas viacerých generácií. V takýchto štúdiách, ako sa zvyšuje príbuzenská plemenitba, sa škodlivé mutácie zvyčajne viac a viac koncentrujú v populácii prostredníctvom procesu nazývaného odmaskovanie, čím sa riskuje celková kondícia populácie. Ako sa populácia stáva čoraz menšou a inbrednejšou, škodlivé genetické podmienky sa stávajú bežnejšími.

Gény samozrejme nepôsobia izolovane. Interakcia medzi génmi a prostredím je zásadná. V niektorých prípadoch to môže spôsobiť, že depresia príbuzenského kríženia je ústredným bodom ohrozených druhov, pretože vonkajšie hrozby, ako napríklad strata biotopu, môžu ohroziť vyhynutie skôr, ako si depresia príbuzenského kríženia vyžiada príliš veľkú daň. Žiaľ, vysoko ohrozené druhy bežne žijú v stresujúcich prostrediach. Inými slovami, ich situácia v skutočnom svete môže byť horšia, ako modely predpokladajú, a inbredné populácie čelia ešte nižšej pravdepodobnosti prežitia ako zdravé populácie.

Okrem toho, malá populácia druhu vo voľnej prírode nie je to isté ako umelo malá populácia v laboratóriu. Laboratórna populácia Drosophila je napríklad vzorkou celej obrovskej dostupnej genetickej diverzity Drosophila. V prípade skutočne malej ohrozenej populácie je celková genetická diverzita nízka a akákoľvek genetická diverzita, ktorá sa vyskytne v redukovanej populácii, je všetko, čo sa nazýva, situácia nazývaná úzke miesto. Niekedy sú nebezpečné mutácie bežné - a to môže priamo ohroziť vyhynutie.

Získajte náš spravodaj

Každý gén má rôzne varianty, nazývané alely, ktoré vznikajú mutáciou. Jedna alela génu môže byť prospešná, ale iná alela toho istého génu môže spôsobiť ujmu. V úzkom mieste je väčšina rôznych alel, vrátane škodlivých, neobvyklá. Niekedy je smrteľná alela demaskovaná a prejaví sa u jedinca, pričom tohto jedinca zabije alebo zabráni reprodukcii. Pretože škodlivá alela je na začiatku zriedkavá, tento výsledok odstráni tieto škodlivé alely z populácie. V takýchto prípadoch kríženie urýchľuje stratu nebezpečných alel, čo môže byť prinajmenšom dočasne prospešné. Na druhej strane, alely, ktoré sú škodlivé, ale nie devastujúce, sa v malých populáciách ľahko fixujú, čo časom zákerne znižuje kondíciu.

Dobrou správou je, že niekedy sa kríženie dá zmierniť alebo dokonca zvrátiť starostlivým zavedením génov. To môže znamenať opätovné zavedenie jedincov odchovaných v zajatí alebo selektívny prenos medzi izolovanými skupinami. Takéto činy samotné prinášajú riziká, ale ak je príbuzenská plemenitba dosť strašná, môže byť potrebná drastická akcia.


Výsledky

Genotypizácia a imputácia

Všetci jedinci štúdie boli genotypovaní na Illumina Ovine SNP50 BeadChip testovaní 51 135 SNP. Okrem toho bolo genotypovaných 189 jedincov na čipe Ovine Infinium High-Density, ktorý obsahuje 606 066 SNP. Aby sme zvýšili genomické rozlíšenie pre naše analýzy, skombinovali sme autozomálne genotypy z obidvoch čipov SNP s informáciami o pôvode, aby sme pomocou AlphaImpute 56 napočítali chýbajúce SNP u jedincov genotypizovaných s nižšou hustotou markerov. Krížová validácia ukázala, že imputácia bola úspešná, s mediánom 99,3% správne imputovaných genotypov na jednotlivca (doplnková tabuľka 1). Navyše, odvodené koeficienty príbuzenskej plemenitby FROH boli veľmi podobné pri porovnávaní jedincov genotypovaných na čipe s vysokou hustotou (medián FROH = 0,239) a jedinci s imputovanými SNP (medián FROH = 0,241), čo naznačuje žiadnu zjavnú odchýlku v množstve odvodených ROH na základe imputovaných údajov (doplnkový obrázok 1). Po kontrole kvality súbor genómových údajov obsahoval 417 373 polymorfných a autozomálnych SNP s priemernou frekvenciou malých alel (MAF) 23 % (doplnkový obrázok 2) a priemernou mierou hovorov 99,5 % u jednotlivcov.

Vzory príbuzenského kríženia v genóme

Najprv sme skúmali, ako je kríženie a dlhodobá veľkosť malej populácie (odhadované N.e = 194 57 )-tvarované vzory ROH u oviec Soay (obr. 1). Jednotlivci mali v priemere 194 ROH (sd = 11,6) dlhšie ako 1,2 Mb, čo v priemere tvorilo 24 % autozomálneho genómu (t.j. priemer FROH = 0,24, rozsah = 0,18–0,50, doplnkový obrázok 3). Priemerný individuálny koeficient inbrídingu FROH oviec narodených v danom roku zostalo v priebehu študijného obdobia konštantné (doplnkový obrázok 4). Medzi jednotlivými variáciami v dĺžke ROH bola vysoká: priemerný ROH u siedmich najkrvavejších oviec bol viac ako dvakrát dlhší ako ROH u siedmich najmenej krížených oviec (6,83 vs. 2,72 Mb, v uvedenom poradí, obr. 1a), hoci priemerný počet ROH bol podobný (170 vs. 169, v uvedenom poradí).

a ROH dlhší ako 5 Mb u siedmich jedincov s najvyššími koeficientmi príbuzenskej plemenitby FROH v siedmich horných radoch a siedmych jedincov s najnižším FROH v siedmich spodných radoch. b Rozdelenie ROH medzi rôzne dĺžkové triedy. Každý údajový bod predstavuje podiel ROH určitej dĺžky v rámci autozomálneho genómu jednotlivca. Triedy dĺžky ROH boli kategorizované podľa ich očakávanej priemernej fyzickej dĺžky, keď základné haplotypy mali najnovšieho spoločného predka (MRCA) 2–32 generácií (g). c Hustota ROH v celom genóme medzi všetkými 5952 jedincami v neprekrývajúcich sa 500 kB oknách. Farebný gradient bol upravený podľa hustoty ROH, ktorá je uvedená v legende obrázku.

Hojnosť ROH u oviec Sayay sa tiež značne líšila v rámci tried dĺžky ROH (obr. 1b). Najväčšia časť IBD v populácii pozostávala z ROH medzi 2,4 a 4,9 Mb pochádzajúcich zhruba pred 8 až 16 generáciami, čo predstavovalo v priemere 8,1% genómu jednotlivca. Dlhé ROH> 19,5 Mb boli nájdené u 38,2% jedincov (obr. 1b). Dlhé ROH však tvorili v priemere len 0,6 % genómu najmenej inbredných jedincov s rodokmeňovým príbuzenským krížením. Fped < 0,1. Na rozdiel od toho dlhý ROH rozšíril viac ako 7% a 18% genómu u inbredných jedincov s Fped > 0,1 a Fped > 0,2, v uvedenom poradí (doplnkový obrázok 5).

Frekvencia ROH v populácii sa v rámci genómu značne líšila (obr. 1c). Skenovali sme ROH v neprekrývajúcich sa 500 Kb oknách a 0,5% okná s najvyššou hustotou ROH sme klasifikovali ako ostrovy ROH a 0,5% okná s najnižšou hustotou ROH ako púšte ROH 31. Horný ostrov ROH na chromozóme 1 (227–227,5 Mb) obsahoval ROH v 87% jedincov, zatiaľ čo iba 4,4% jedincov malo ROH v hornej púšti ROH na chromozóme 11 (58,5–59 Mb, v doplnkovej tabuľke 2 nájdete zoznam najlepších púští a ostrovov ROH).

Hustota ROH a rýchlosť rekombinácie

Veľké rozdiely v hustote ROH pozdĺž genómu by sa dali čiastočne vysvetliť rekombináciou, pretože oblasti s vysokou mierou rekombinácie produkujú kratšie ROH a je menej pravdepodobné, že ich detegujú algoritmy volania ROH30. Rekombinácia sama osebe neovplyvňuje skutočný skutočný podiel IBD, ale ovplyvňuje iba distribúciu dĺžky ROH. V dôsledku toho by oblasti s vysokou rekombináciou mohli vytvárať domnelé púšte ROH bez zmeny skutočných hladín IBD, pretože je menej pravdepodobné, že sa krátke ROH nazývajú 30 . Aby sme vyhodnotili, koľko variácií hustoty ROH v genóme je dôsledkom variácií rýchlosti rekombinácie a koľko z nich sleduje základné hladiny IBD, skonštruovali sme lineárny zmiešaný model s hustotou ROH (podiel jedincov s ROH) meranou v 500 kB. okná ako premenná odozvy, miera rekombinácie okien v cM/Mb na základe mapy 58 väzby Soay oviec a heterozygotnosť okna SNP ako fixné efekty, ako aj identifikátor chromozómu ako náhodný efekt.

Rýchlosť rekombinácie a heterozygotnosť spolu vysvetľujú 42 % variácií v hustote ROH (hraničná R. 2 = 0,42, 95% IS [0,40, 0,44], doplnková tabuľka 3A), pričom väčšina variácií je vysvetlená heterozygotnosťou (polodielna R. 2 = 0,38, 95 % CI [0,36, 0,40], obr. 2b) a len okolo 4 % vysvetlené mierou rekombinácie (poločiastočná R. 2 = 0,04, 95 % CI [0,02, 0,07], obrázok 2a a doplnkový obrázok 6 pre chromozómový graf). Vzorec je podobný pri opätovnom spustení modelu iba na oknách označených ako ostrovy a púšte ROH, kde je hustota ROH do značnej miery vysvetlená heterozygotnosťou (polodielna R. 2 = 0,89, 95% IS [0,83, 0,94], obr. 2d), pričom iba malá časť variácií je vysvetlená variáciou rýchlosti rekombinácie (polodielna R. 2 = 0,07, 95 % CI [0,01, 0,12], obr. 2c). V dôsledku toho, hoci rýchlosť rekombinácie ovplyvňuje dĺžky ROH, a teda aj pravdepodobnosť detekcie ROH, predstavuje to len malú časť variácií v zistenej hustote ROH, ktorá väčšinou odráža základné vzorce IBD pozdĺž genómu.

Cykly hustoty homozygotnosti (ROH), rýchlosti rekombinácie a heterozygotnosti boli kvantifikované v neprekrývajúcich sa 500 Kb oknách, pričom každý bod predstavoval jedno okno. Horných 0,5% okien s najvyššou a najnižšou hustotou ROH v populácii, označovaných ako ostrovy ROH (n = 24) a púšte (n = 24), sú vo všetkých štyroch grafoch zafarbené purpurovo a žlto. a Vzťah medzi hustotou ROH a rýchlosťou rekombinácie. b Vzťah hustoty ROH a heterozygotnosti SNP. c Miera rekombinácie v rámci ostrovov a púští ROH. d Heterozygotnosť na ostrovoch a púšťach ROH. Plné čiary v aab sú lineárne regresné čiary a prerušované čiary v c a d sú prostriedkami celého genómu. Boxploty ukazujú medián ako stredovú čiaru s hranicami rámčeka ako 25. a 75. percentil a horné a dolné fúzy ako najväčšiu a najmenšiu hodnotu, ale nie ďalej ako 1,5 * medzikvartilného rozsahu od závesu. Zdrojové údaje pre tento obrázok sú tiež poskytnuté ako súbor zdrojových údajov.

Nakoniec sme skúmali, koľko variácií v hustote ROH bolo vysvetlených rekombináciou pri použití rôznych minimálnych prahových hodnôt ROH. Zopakovali sme analýzu so súborom údajov na základe minimálneho prahu dĺžky ROH 0, 4 Mb a druhého súboru údajov s minimálnou dĺžkou ROH 3 Mb (doplnková tabuľka 3B, C). V porovnaní s pôvodným súborom údajov s minimálnou dĺžkou ROH 1,2 Mb, rekombinácia vysvetlila menšie variácie v hustote ROH v súbore údajov vrátane kratšieho ROH (polodielneho R. 2 = 0,01, 95% IS [0,00, 0,04]) a viac variácií v súbore údajov pozostávajúcom iba z dlhších ROH (polodielnych R. 2 = 0,08, 95% IS [0,06, 0,11]). V dôsledku toho má variácia rýchlosti rekombinácie väčší vplyv na zistené množstvo dlhších ROH v genóme.

Inbrídingová depresia v prežívaní

Prežitie je kľúčovou zložkou fitness. U oviec Sayay zomiera viac ako polovica všetkých jedincov počas ich prvej zimy, čím sa minimalizujú ich šance na reprodukciu (doplnkový obrázok 7). Prežitie oviec sa hodnotí prostredníctvom rutinných kontrol úhynu, ktoré sa vykonávajú počas celého roka. Viac ako 80% oviec v študovanej oblasti sa nachádza po ich smrti 50, čo celkovo znamená 15 889 ročných pozorovaní prežitia 5952 oviec. Rozdelenie jednotlivých koeficientov príbuzenského kríženia FROH v rôznych vekových triedach odhalili, že vysoko inbrední jedinci len zriedka prežijú svoje rané roky života a nikdy nedosiahnu starobu (obr. 3a). Zdá sa však, že sila inbreedingovej depresie vo vyššom veku klesá (obr. 3b). Napríklad u oviec starších ako štyri roky bol podiel preživších medzi najviac inbrednými jedincami len nepatrne nižší ako medzi najmenej inbrednými jedincami (obr. 3b).

a Rozdelenie inbreedingových koeficientov FROH vo vekových triedach oviec Soay v rozmedzí od 0 do 9 rokov. b Podiel prežívajúcich jedincov za rok v štyroch rôznych životných etapách a medzi rôznymi FROH triedy. Pretože vysoko inbrední jedinci sú relatívne vzácni, posledná trieda zahŕňa širší rozsah koeficientov príbuzenského kríženia. Zdrojové údaje pre tento obrázok sú tiež poskytnuté ako súbor zdrojových údajov. c Predpovedaná pravdepodobnosť prežitia a 95% dôveryhodné intervaly v rozsahu koeficientov príbuzenského kríženia FROH pre každú fázu života, pričom sex a dvojča držia konštantne na 1 (muž) a 0 (žiadne dvojča). Predpovede pre triedy neskorších životných fáz presahujú rozsah údajov, ale na porovnateľnosť sú uvedené v celom rozsahu.

Modelovali sme silu inbreedingovej depresie počas celého života pomocou zvieracieho modelu s binomickou distribúciou chýb a ročným prežitím ako premennou reakcie. Celkovo bol vplyv príbuzenskej plemenitby na prežitie silný: u jahniat (vek 0 rokov) došlo k 10 % zvýšeniu FROH bola spojená s 0,4 multiplikatívnou zmenou v pravdepodobnosti prežitia (pomer pravdepodobnosti, OR [95 % dôveryhodný interval, CI] = 0,40 [0,30, 0,53], doplnková tabuľka 4) alebo 60 % zníženie (1–0,40) v šance na prežitie. To sa premieta do nelineárnych rozdielov prežitia na stupnici pravdepodobnosti. Napríklad samec ovečky Sheay, ktorá nie je dvojčaťom, s FROH 10 % nad priemerom malo o 23 % nižšiu pravdepodobnosť, že prežije svoju prvú zimu v porovnaní s priemerným jahňaťom (FROH = 0,34 vs. FROH = 0,24 Obr. 3c). Počas životnosti model odhaduje interakcie medzi nimi FROH a rôzne štádiá života predpovedali pokles sily depresie príbuzenského kríženia v neskorších fázach života (obr. 3c) s najväčším predikovaným rozdielom medzi raným (vek 1, 2) a neskorým životom (vek 5+, ALEBO [95% CI ] = 2,03 [1,08, 3,82], doplnková tabuľka 4).

Ďalej sme odhadli zaťaženie príbuzenského kríženia u oviec Soay ako diploidný počet smrteľných ekvivalentov 2B. Smrteľné ekvivalenty sú koncepciou zakorenenou v populačnej genetike, kde jeden smrteľný ekvivalent sa rovná skupine mutácií, ktoré by v prípade rozptýlenia medzi jednotlivcami spôsobili v priemere jednu smrť 59 . Nasledovali sme návrhy Nietlisbacha a kol. 60 a upravil model prežitia pomocou funkcie Poissonovej distribúcie a logaritmického spojenia pomocou zjednodušenej štruktúry modelu bez interakcií pre lepšiu porovnateľnosť medzi štúdiami. To poskytlo odhad 2B = 4,57 (95% IS 2,61–6,55) smrteľné ekvivalenty pre ročné prežitie oviec Sayay.

Genetická architektúra inbreedingovej depresie

Na kvantifikáciu dôsledkov prežitia IBD na každom mieste SNP sme použili modifikovanú celogenómovú asociačnú štúdiu (GWAS). Na rozdiel od tradičných GWAS kde p-zaujímavé sú hodnoty aditívnych účinkov SNP, analyzovali sme efekty stavu ROH pre obidve alely pri každom SNP. Konkrétne, na dialelickom lokuse ROH vzniká buď z dvoch haplotypov IBD obsahujúcich alelu A alebo z dvoch haplotypov IBD obsahujúcich alelu B. Ak v populácii existujú silne škodlivé recesívne alely, môžu byť spojené s ROH na základe haplotypov alely A alebo na báze ROH na haplotypoch alely B. Aby sme to otestovali, vytvorili sme binomický zmiešaný model ročného prežitia pre každú pozíciu SNP. V každom modeli sme umiestnili dva prediktory stavu ROH. Prvému prediktoru bola priradená 1, ak alela A bola homozygotná a časť ROH a 0 inak. Druhý prediktor bol priradený 1, ak alela B bola homozygotná a časť ROH a 0 inak. Modelové odhady a p-hodnoty týchto dvoch prediktorov teda odrážajú, či sú ROH spojené s dôsledkami prežitia na každom mieste SNP a pre každú alelu. V modeli GWAS sme tiež kontrolovali aditívny efekt SNP a priemer individuálneho príbuzenského kríženia FROH (založené na všetkých autozómoch okrem ohniskového chromozómu), spolu s radom ďalších individuálnych vlastností a účinkov na životné prostredie (podrobnosti nájdete v časti „Metódy“).

GWAS na alelovom stave ROH môže detekovať škodlivé recesívne alely v špecifických oblastiach, keď účinky ROH dosiahnu význam pre celý genóm. Okrem toho distribúcia účinkov stavu ROH v genóme môže byť tiež informatívna o celkovom počte škodlivých recesívnych alel, ktoré prispievajú k depresii inbrídingu prostredníctvom ROH. Podľa nulovej hypotézy, že stav ROH nemá vplyv na prežitie v žiadnej pozícii SNP, by sme kvôli náhode očakávali distribúciu negatívnych a pozitívnych odhadov stavu ROH v pomere 50/50. Na rozdiel od toho sme zistili oveľa viac negatívnych ako pozitívnych účinkov stavu ROH na prežitie v celom genóme, ako sa očakávalo náhodou (obr. 4a, b 465 K neg. vs. 354 K poz. presný binomický test p = 2,2 x 10 - 16). Podiel negatívnych účinkov ROH sa navyše zvyšuje pre väčšie modelové odhady (obr. 4a) a menšie p-hodnoty (obr. 4b). Testovali sme to štatisticky pomocou dvoch binomických generalizovaných lineárnych modelov (GLM), so smerom účinku ako binárnou odpoveďou a odhadom modelu a p-hodnota, ako prediktory. Účinky ROH boli pravdepodobnejšie negatívne, keď bol ich modelový odhad väčší (log-OR [95% CI] = 0,35 [0,344, 0,358]) a keď boli ich odhady p-hodnota bola menšia (log-OR [95 % CI] = -3,82 [-3,84, -3,80]). V dôsledku toho je pravdepodobné, že veľký počet recesívnych škodlivých alel prispieva k depresii príbuzenského kríženia, ktorá sa prejavuje negatívnymi účinkami ROH rozšírenými v mnohých lokusoch.

Regionálna inbrídová depresia bola konceptualizovaná a testovaná pomocou dvoch binárnych prediktorov stavu ROH. Jeden z prediktorov kvantifikoval stav ROH alely A (v ROH = 1, nie v ROH = 0), zatiaľ čo druhý kvantifikoval stav ROH alely B. a Distribúcia veľkostí efektov pre efekty stavu ROH podľa SNP. b Distribúcia p-hodnoty pre účinky stavu ROH podľa SNP. Žlté histogramy s pozitívnymi účinkami sa prekrývajú s fialovými histogramami s negatívnymi účinkami, aby sa zvýraznil podstatne väčší podiel negatívnych účinkov stavu ROH, ako sa náhodne očakávalo. c Graf Manhattanu o stave ROH p-hodnoty v celom genóme. Prerušovaná čiara označuje prah významnosti v celom genóme pre Bonferroniho korekciu, ktorá bola založená na účinnom počte testov pri účtovaní nerovnováhy väzieb.

GWAS odhalil v celom genóme významné efekty ROH v siedmich oblastiach na chromozómoch 3 (dve oblasti), 10, 14, 18, 19 a 23 (obr. 4c a doplnková tabuľka 5). V piatich z týchto oblastí bol stav ROH pre jednu z alel spojený s negatívnymi účinkami na prežitie, pravdepodobne spôsobenými relatívne silne škodlivými recesívnymi alelami. ROH v dvoch ďalších oblastiach na chromozómoch 3 a 19 boli spojené so zvýšenou pravdepodobnosťou prežitia, pravdepodobne v dôsledku haplotypov s pozitívnymi účinkami na prežitie. To explore the genomic regions with large ROH effects further, we quantified the ROH density and SNP heterozygosity in 2 Mb windows around the top GWAS hits (Supplementary Fig. 8). Strongly deleterious recessive alleles might be expected to occur in regions of elevated heterozygosity where they are rarely expressed in their homozygous state. Heterozygosity was higher than average around the top SNPs on chromosomes 10, 14, 18 and 23, and ROH frequency was lower around the top SNPs on chromosomes 10, 18, 19 and 23, but overall, but we did not observe a convincing pattern of genetic diversity across the five regions harbouring strongly deleterious mutations (Supplementary Fig. 8).


THE GENETIC INTERPRETATION OF INBREEDING DEPRESSION AND OUTBREEDING DEPRESSION

Inbreeding with close relatives and outbreeding with members of distant populations can both result in deleterious shifts in the means of fitness-related characters, most likely for very different reasons. Such processes often occur simultaneously and have important implications for the evolution of mating systems, dispersal strategies, and speciation. They are also relevant to the design of breeding strategies for captive populations of endangered species. A general expression is presented for the expected phenotype of an individual under the joint influence of inbreeding and crossbreeding. This expression is a simple function of the inbreeding coefficient, of source and hybridity indices of crossbreeding, and of specific forms of gene action. Application of the model may be of use in identifying the mechanistic bases for a number of evolutionary phenomena such as the shift from outbreeding enhancement to outbreeding depression that occurs with population divergence.

Kľúčové slová: Inbreeding depression outbreeding depression.


MATERIÁLY A METÓDY

Study species and populations

Witheringia solanacea is a small shrub that extends from southern Mexico and the Caribbean to South America (D𠆚rcy, 1973). It possesses the gametophytic SI system characteristic of the Solanaceae, where allele-specific S-RNases expressed in the style cause the degradation of RNA, and therefore the death of pollen tubes bearing the cognate S-allele (McClure et al., 1990). The floral biology of W. solanacea is described in detail by Bohs (2000). Its flowers are pollinated by small bees and its fleshy fruits are bird-dispersed. Witheringia solanacea also reproduces prolifically by vegetative reproduction in gardens and along trailsides. Cuttings were collected in the field from Costa Rican populations and maintained in the greenhouse at Colby College. Populations and locations have been described by Stone and Pierce (2005) and Stone et al. (2006). Plants were sampled from populations in three geographic regions. Self-incompatible plants were sampled from large populations in the Las Cruces region, at 1180� m a.s.l. in southwestern Costa Rica, and the Monteverde region in northwestern Costa Rica, extending from 1100 m elevation in the San Luis Valley to 1500 m a.s.l. in the village of Monteverde. The SC individuals came from the very small population at Vara Blanca at 1360 m a.s.l. in central Costa Rica and from the undescribed but morphologically distinct variety at lower elevations in the Monteverde region. Treatments were carried out on seven SI individuals from Las Cruces and 13 from Monteverde, in addition to the two strongly SC individuals available from Vara Blanca and three from Monteverde. The low sample size of SC plants was a consequence of the relative scarcity of the SC phenotype in Monteverde and the tiny overall size of the population in Vara Blanca, which over a decade of monitoring has never been found to contain more than six individuals.

Pollen chase experiment and pollen tube growth

For each trial, we conducted 3𠄶 pairs of SO and OO treatments over a period of 1 week to 10 days. During the summers of 2004�, 48 trials were carried out: seven on SC plants, 14 on Las Cruces plants, and 27 on Monteverde plants. Pollen was collected in clean vials and applied using clean toothpicks to styles of unopened flowers, 24 h before anthesis. Buds at this stage can be identified because they are still tightly closed but have developed the green splotches that decorate the corolla of mature flowers. Pairs of buds were chosen on each recipient, the bud for the SO treatment receiving self-pollen, and the bud for the OO treatment receiving outcross pollen. Twenty-four hours later, outcross pollen from a single compatible donor was applied to both flowers. Previous work in our laboratory has shown that although bud self-pollinations produce fewer pollen tubes at the base of the style than do bud outcross-pollinations, both types of pollinations produce tubes that grow past midstyle at 24 h and reach the base of the style by 48 h. Therefore, we assume that 24 h priority is sufficient to ensure that bud self-pollen tubes reach the base of the style before the subsequent outcross pollen tubes do. In total, 852 pollinations were done, half of which were bud pollinations. Fruits were allowed to ripen, and seeds were counted.

Germination and genotyping

To compare germination rates among treatments for SI populations, we planted seeds from fruits representing all available mothers and cross types. In most instances, 20 seeds were planted per cross, but in some cases all seeds per fruit were planted. We planted five seeds per cell in a 128-cell flat filled with Metro-Mix 200 (Sun-Gro Horticulture, Vancouver, British Columbia, Canada), alternating the position of cells occupied by seeds from SO and OO fruits. Seeds were covered with a fine layer of vermiculite, and the flats were placed in a mist bench under 12-h light/12-h dark in the greenhouse at Colby College. Liquid fertilizer was applied weekly once initial sprouts appeared. Germination was recorded at 6 wk, at which time seedlings were transplanted to individual cells and randomly placed on the bench. Seedlings were harvested by clipping with scissors at ground level at 12 wk and air dried.

To detect the level of self-fertilization resulting from the SO treatment, we used five microsatellite loci to genotype progeny and parental plants. We genotyped 73 progeny from 13 SO pollinations on eight maternal plants. Microsatellite-enriched libraries were developed by Craig Newton of ATG genetics (Vancouver, Washington. USA). We amplified inserts using universal m13 primers, sequenced the inserts using an ABI 3130 genetic analyzer (Applied Biosystems, Foster City, California, USA), and designed primers using the program Primer3 (Rozen and Skaletsky, 2000). Primer sequences appear in Table 1 .

Stôl 1

Primer sequences for microsatellite genotyping of Witheringia solanacea.

názovSequenceTm (ଌ)Product length (bp)Alleles in sample
WsolgataA6Lctgctacccatggctcaact60.28185�6
WsolgataA6Rttttctcggttgcaatggtt60.48
WsolcaA3Lgcaaaatacagtcaacacaatgaa59.10244�2
WsolcaA3Rgctcacgtggtgtttgtaga57.30
WsolcaE1Lcgatccacatcagctgaaaa59.80187�3
WsolcaE1Racccaggaattggggtaaga60.55
WsolcaE2Lgcggatccaggacatgaata60.83209�3
WsolcaE2Rctcctgcgacctgtctgttt60.44
WsolcaE9Ltccctcattggtaagggatg59.74154�4
WsolcaE9Rcgaccagtgctagctgacaa60.20

We extracted genomic DNA using the Qiagen (Germantown, Maryland, USA) DNeasy Plant Mini Kit on 40 mg dried leaf material, using dry ice to keep the tissue brittle for grinding in the Qiagen tissue lyser. PCR was carried out in 25 μL volumes in standard buffer with 1.5 mM MgCl2, 0.8 mM dNTPs, 0.5 μM each primer, 2 U Taq polymerase, and 10 ng genomic DNA. In each reaction, the left primer was fluorescently tagged with 6-FAM. A touchdown PCR program was used, with the annealing temperature decreasing from 60ଌ to 50ଌ by 0.5° each cycle for the first 20 cycles and kept at 50ଌ thereafter. Other PCR conditions were an initial denaturation at 95ଌ for 2.5 min and 35 cycles with 95ଌ for 20 s, annealing for 30 s, and extension at 72ଌ for 30 s with a final extension at 72ଌ for 10 min. PCR products were suspended in deionized formamide with ROX-500 size standard (Applied Biosystems) and run under standard conditions on an ABI 3130 genetic analyzer. Peaks were visualized using GeneScan and scored manually.

Analýza dát

For the two SI populations, we used a two-way ANOVA to compare fruit and seed set of SO and OO treatments, with population as a random factor and treatment as a fixed factor. Maternal plant was nested within population. Treatment and the population × treatment interaction were tested over treatment × maternal plant nested within the population. To meet assumptions of ANOVA, proportion fruit set was arcsine-transformed, and seed number per plant per treatment was averaged and square-root transformed. The low number of available SC plants made it impossible to evaluate assumptions of parametric tests. For analyses involving SC plants, we used a Wilcoxon’s matched pairs signed rank test for paired comparisons, a Mann–Whitney test for unpaired comparisons, and Kruskal–Wallis tests for comparisons involving all three populations. Nonparametric tests were also used for germination data. Mann–Whitney tests were done by hand, and the program Stata 10.1 (Stata-Corp, College Station, Texas, USA) was used for all other analyses. The cumulative embryonic fitness decline associated with self-precedence was calculated for each individual according to the formula: δ = 1 − (wsf/wz · wss/wos), kde wsf = proportion of SO pollinations producing fruit, wz = proportion of OO pollinations producing fruit, wss = average seed number resulting from SO pollinations, wos = average seed number resulting from OO pollinations.

To estimate the selfing rate for SO fruits, we calculated the probability, at each locus, that each offspring was a product of self-fertilization. If any locus revealed a definitive outcrossing event, the progeny was recorded as an out-cross. If no loci revealed definitive outcrossing, the likelihood of selfing was found by multiplying the probabilities across loci.

Pollen tube data, together with selfing rate estimates, allowed us to account for residual SI in the estimate of embryonic inbreeding depression. Bud self-pollination of SI plants from the Monteverde population yielded an average of 37 pollen tubes at the base of the style, whereas bud self-pollination of SI plants from Las Cruces yielded an average of only 13 pollen tubes at the base of the style (Stone et al., 2006). The number of pollen tubes at the base of the style after bud self-pollinations provides the maximum number of selfed seeds that could be expected under bud self-pollination. Any seeds in excess of that expectation should be due to the outcross pollination done on the second day of the pollen chase experiment. An expected selfing rate can therefore be obtained by comparing the number of self-pollen tubes with the total number of seeds. The observed selfing rate of surviving progeny as obtained by microsatellite genotyping was compared with the expected rate to estimate the relative postzygotic fitness of selfed progeny.


What impact has recent inbreeding had on the genetic diversity of domestic dogs?

Research published today in Canine Genetics and Epidemiology investigated the rate of inbreeding in domestic dog breeds recognized by The Kennel Club. Here, Tom Lewis explains more.

The term ‘inbreeding’ is widely associated with severe physiological (and in humans, mental) impairment as a consequence of parents being closely related. As a result, incestuous relationships are a widespread cultural taboo, with laws against incestuous marriages, at least of first degree relatives, almost universally present throughout the world.

However, it is actually very difficult to avoid any degree of relationship between two parents. In part this is due to simple mathematics – the number of ancestors increases exponentially with each generation further back (two parents, four grand-parents, eight great-grand-parents) meaning that it is inevitable there will be some degree of common ancestry if we go back far enough.

Less well understood however, and particularly important for domestic animal species, is the intrinsic relationship between inbreeding and selection.

Less well understood however, and particularly important for domestic animal species, is the intrinsic relationship between inbreeding and selection.

That relatives resemble each other is a central tenet of genetics. Therefore, if we select breeding animals that resemble each other with respect to a particular trait, then these individuals will on average be more closely related than if mating was random.

This means that selection will lead to some degree of inbreeding. Consequently, rather than attempting to avoid any inbreeding in domestic animal populations at all, a more useful strategy is to manage the loss of genetic diversity (rate of inbreeding) to within sustainable levels.

Calculating the rate of inbreeding

The domestic dog shows a greater variety in appearance and behavior than any other domestic species. Many distinct breeds were formed and are maintained by closed registries which have led to the widespread belief that pedigree dogs are very inbred.

Crucially however, the rigorous recording of pedigree data provides large datasets from which genetic parameters and historical trends can be determined, and this information used to guide future breeding strategies.

The rates of inbreeding calculated in all 215 domestic dog breeds recognized by the Kennel Club over the period 1980 to 2014 form the results central to a study recently published in Canine Genetics and Epidemiology. Although the precise profile of rate of loss of genetic diversity is unique for each breed, the study did determine some broad trends.

What did we find?

There was a general contraction of within-breed genetic diversity in the 1980s and 1990s, with the overall rate of inbreeding at a level at which detrimental effects, such as inbreeding depression, would be expected to be observed. However, since the turn of the century the rate of inbreeding has tended to decline across breeds, implying breeders have taken steps to conserve genetic diversity.

Interestingly this general decline in the rate of inbreeding coincides with the relaxation of the UK’s quarantine laws. This suggests that breeders may have taken the opportunity provided by new laws easing travel restrictions for dogs to slow the erosion of genetic diversity, or even re-introduce some genetic variation, through more widespread use of non-UK animals in breeding.

Perhaps surprisingly there appeared to be no relationship between the rate of inbreeding observed and population size.

Perhaps surprisingly there appeared to be no relationship between the rate of inbreeding observed and population size (as judged by mean number of Kennel Club registrations). This implies that it is possible to conserve genetic diversity via a sustainable rate of inbreeding in small populations, perhaps through judicious use of migrant animals for breeding to provide an injection of genetic diversity to the population.

The existence of popular sires, or male parents, was observed in virtually all pedigree dog breeds in the study. The repeated use of prolific breeding males is both often a feature of selection and a contributor to a high rate of inbreeding, and is typical in breeding practices of almost all domestic mammal species.

Intense selection in males

The much greater reproductive capacity of males compared to females means more intense selection can be applied to males, and the few selected then make a far greater individual genetic contribution to future generations.

While this results in widespread dissemination of genes influencing ‘sought after’ traits (the response to selection), it also makes such males much more likely to be a common ancestor to all breeding animals in subsequent generations, increasing the rate of inbreeding.

The challenge remains, for the dog as for other domestic species, to achieve sufficient response to selection (for traits related to health, temperament, and so on) at a rate of loss of genetic diversity which is sustainable.