Informácie

Ako sa RNA retrovírusu premieňa na cDNA?

Ako sa RNA retrovírusu premieňa na cDNA?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Retrovírus (onkovírus) obsahuje RNA. Má tiež molekulu nazývanú reverzná transkriptáza. Táto molekula prepisuje RNA na cDNA. Táto cDNA je kópiou DNA vírusového RNA genómu

RNA má uracil namiesto tymínu a DNA má tymín namiesto uracilu. Ako teda možno RNA premeniť na DNA? Kam ide Uracil a odkiaľ pochádza tymín?


RNA má uracil namiesto tymínu a DNA má tymín namiesto uracilu. Ako teda možno RNA premeniť na DNA?

Myslím, že možno budete chcieť položiť základnejšiu otázku. DNA a RNA sú veľmi podobné, rozdiel je iba v kyslíku. To má obrovské dôsledky pre organizmy a život, ako ho poznáme, používa DNA a RNA na veľmi odlišné účely. DNA uchováva genóm poskytujúci pokyny pre život a RNA v skratke je spôsob, akým sa táto správa premení na bielkovinu pre užitočnú akciu. RNA je vo všeobecnosti menej stabilná ako DNA, takže toto usporiadanie funguje dobre.

DNA sa pravidelne a neustále prepisuje na RNA, takže tymín sa pravidelne používa v prospech Uracilu. Existuje a fantastický odpoveď tu na Biology.SE sa už zaoberá prečo tak to odporúčam prečítať. The ako je celkom jednoduché, používajú sa rôzne molekuly! DNA polymerázy obsahujú tymín, zatiaľ čo RNA polymerázy obsahujú uracil. Reverzná transkriptáza, ktorá je kódovaná retrovírusom, robí práve toto: prepisuje RNA na DNA pomocou tymínu namiesto uracilu. Uracil aj tymín sú prítomné v bunke a sú teda dostupné na použitie.


Myslím, že by mohlo byť užitočné ukázať vám rozdiel medzi uracilom a tymínom

Sú to veľmi podobné štruktúry. Časť, ktorá sa podieľa na párovaní báz, je v skutočnosti dusík a kyslík, ktorý je najďalej od cukru. Pozri nižšie:

Takže extra metylová skupina na druhej strane molekuly nepreruší párovanie báz. A pamätajte, že pri syntéze DNA/RNA máte šablónu a nové vlákno je založené na šablóne. Takže, keď RT enzým spomínaný Medhatom narazí na adenín v templátovej RNA, spáruje ho s tymidínom. A keď sa stretne s uracilom, je schopný ho spárovať s adenínom. Enzým je špecificky štruktúrovaný tak, aby umožňoval len tymín a nie uracil, čím sa odlišuje.


CDNA syntéza

Nech sú vaše požiadavky akékoľvek, existuje súprava na syntézu cDNA Bio-Rad, ktorá vyhovuje vašim potrebám.

Syntéza cDNA Reliance Select
Súprava

Vyberte súpravu Reliance Select cDNA Synthesis Kit na zachytenie cieľov bohatých na GC a sekundárnej štruktúry v FFPE a zložitých vzorkách s degradovanou RNA alebo inhibítormi.

Reverzná transkripcia Supermix
pre RT-qPCR

Vyberte si supermix pre reverznú transkripciu iScript pre rýchlu, efektívnu a citlivú syntézu cDNA pre RT-qPCR a jednu skúmavku a 40-minútový protokol.

Súprava na pokročilú syntézu cDNA
pre RT-qPCR

Vyberte si súpravu iScript Advanced cDNA Synthesis Kit, ktorá má rozšírený dynamický rozsah s kapacitou až 7,5 mikrogramov vstupnej RNA.


Ako sa RNA retrovírusu premieňa na cDNA? - Biológia

Táto enzýmová reverzná transkriptáza nám umožňuje použiť RNA templát na vytvorenie kópie dvojvláknovej cDNA. Reverznú transkriptázu objavili H. Temin a D. Baltimore pri štúdiu retrovírusov. Retrovírusy obsahujú RNA genóm, ktorý sa premieňa na kópiu DNA a integruje sa do hostiteľského genómu počas svojho replikačného cyklu. Ide o zaujímavý súbor vírusov vrátane mnohých nádorových vírusov a vírusu AIDS HIV.

Reverzná transkriptáza je DNA polymeráza závislá od RNA. Využíva RNA ako templát, vyžaduje dNTP a primer (voľný 3' OH) na iniciáciu polymerizácie DNA.

Bežne sa používajú dva typy primerov.

Oligo-dT iniciuje aktiváciu z 3' konca mRNA.
cDNA primované oligo-dT sú obohatené o 3' konce mRNA.

Náhodné oligonukleotidy môžu hybridizovať kdekoľvek pozdĺž sekvencie mRNA a pripraviť syntézu cDNA. Náhodne primované cDNA sú distribuované po dĺžke templátu, a preto viac reprezentujú populáciu mRNA.

mRNA sú typicky krátke (v porovnaní s genómom) - väčšina mRNA má dĺžku menej ako 6 kb a len vzácne mRNA presahujú dĺžku 10 kb.
Táto malá veľkosť znamená, že plazmidové aj fágové inzerčné vektory sú vhodné na konštrukciu cDNA knižníc
(na rozdiel od genómových knižníc, kde sú preferované fágové substitučné vektory).

V našej diskusii o genómových knižniciach sme sa zamerali na úplné pokrytie genómu.
Náhodné genómové fragmenty boli generované čiastočným štiepením s častým rezacím enzýmom.
Výsledná knižnica náhodných brokovníc obsahuje viacero prekrývajúcich sa klonov, ktoré pokrývajú kompletnú sekvenciu genómu.

Knižnice cDNA sú trochu iné.
Tu každý bakteriálny transformant alebo zabalený fág predstavuje jedinečnú molekulu mRNA.
Rekombinanty obsahujúce rovnakú sekvenciu DNA predstavujú rôzne templátové molekuly prítomné v pôvodnej populácii mRNA.

Napríklad v bunke je v danom čase 100 000 molekúl mRNA
10% z nich sú niektoré vysoko exprimované mRNA (povedzme aktínové mRNA)
potom v primárnej cDNA knižnici pozostávajúcej zo 100 000 klonov,
10 % z nich (10 000) budú aktínové cDNA.
Alebo by ste mohli len skrínovať niekoľko stoviek cDNA a stále nájsť aktínové cDNA.

No, to je veľmi pekné, ak chcete študovať aktín.

Čo ak chcete študovať nejaký vzácny transkripčný faktor, ktorý sa prejavuje len na nízkych úrovniach.
Vo vašich 100 000 mRNA môže byť len 10 mRNA kódujúcich váš transkripčný faktor.
Teraz by ste museli skontrolovať celú svoju knižnicu 100 000 klonov.

Ak bol váš prepis vyjadrený iba na krátky čas na nízkych úrovniach, môže byť prítomný na ešte nižších úrovniach.

Väčšina rekombinantných fágov v štandardnej cDNA knižnici nesie vysoko exprimované sekvencie.
Zriedkavé mRNA je ťažké nájsť, pokiaľ vaša knižnica nie je veľmi veľká (počet rekombinantov – mal by obsahovať viac ako 10 6 nezávislých rekombinantov, aby pokryli populáciu mRNA 100 000 transkriptov s 99% pravdepodobnosťou).

Alternatívou k skríningu zvyšujúceho sa počtu nezávislých rekombinantov je „normalizácia“ knižnice pomocou hybridizačnej kinetiky, ako sme diskutovali vyššie.
Normalizované knižnice obsahujú menej kópií vysoko exprimovaných mRNA (odstránených pri hybridizácii) a viac kópií zriedkavých transkriptov (v relatívnom zmysle).


Retrovírus

Naši redaktori skontrolujú, čo ste odoslali, a rozhodnú, či článok upravia.

Retrovírus, ktorýkoľvek zo skupiny vírusov, ktoré patria do čeľade Retroviridae a ktoré charakteristicky nesú svoj genetický plán vo forme ribonukleovej kyseliny (RNA). Retrovírusy sú pomenované podľa enzýmu známeho ako reverzná transkriptáza, ktorý nezávisle na sebe objavili v roku 1971 americkí virológovia Howard Temin a David Baltimore. Reverzná transkriptáza prepisuje RNA na kyselinu deoxyribonukleovú (DNA), čo je proces, ktorý predstavuje obrátenie obvyklého smeru bunkovej transkripcie (DNA na RNA). Pôsobenie reverznej transkriptázy umožňuje, aby sa genetický materiál z retrovírusu natrvalo začlenil do DNA genómu infikovanej bunky, čo je enzým široko používaný v biologických vedách na syntézu génov.

Retrovírusy spôsobujú rast nádorov a určité druhy rakoviny u zvierat a sú spojené s pomalými infekciami zvierat, ako je napríklad infekčná anémia koní. U ľudí retrovírus známy ako ľudský T-bunkový lymfotropný vírus typu 1 (HTLV-1) spôsobuje formu rakoviny nazývanú dospelá T-bunková leukémia (ATL). Môže tiež spôsobiť neurodegeneratívny stav známy ako myelopatia spojená s HTLV-1/tropická spastická paraparéza (HAM/TSP). Blízko príbuzný vírus s názvom HTLV-2 je spojený s relatívne miernymi neurologickými poruchami, ale nebol identifikovaný ako príčinný činiteľ ľudských chorôb. Predpokladá sa, že až 20 miliónov ľudí na celom svete je infikovaných HTLV, ale len malé percento infikovaných jedincov skutočne vyvinie ATL alebo HAM/TSP. Retrovírus známy ako vírus ľudskej imunodeficiencie (HIV) spôsobuje u ľudí syndróm získanej imunodeficiencie (AIDS). HIV úzko súvisí s vírusom opičej imunodeficiencie (SIV), retrovírusom, ktorý sa vyskytuje u šimpanzov a goríl.

Takzvané endogénne retrovírusy (ERV) sú perzistentnými znakmi genómov mnohých zvierat. ERV pozostávajú z genetického materiálu vyhynutých alebo „fosílnych“ vírusov, ktorých genómová štruktúra je podobná konštitúcii existujúcich retrovírusov. Ľudské ERV (HERV) sa v priebehu evolúcie rozšírili v ľudskej DNA. Prenášajú sa z jednej generácie na druhú a tvoria odhadom 1 až takmer 5 percent ľudského genómu. HERV sú podozrivé z toho, že ovplyvnili evolúciu určitých prvkov ľudského genómu. Tiež sa podieľajú na niektorých ľudských chorobách, vrátane roztrúsenej sklerózy.

HTLV-1 bol prvý objavený ľudský retrovírus, ktorý v roku 1979 detegoval a izoloval americký virológ Robert C. Gallo s kolegami. HIV bol prvýkrát izolovaný v roku 1983.


Rozšírený výskyt a potenciálne biologické úlohy endogénnych vírusových prvkov v genómoch hmyzu

Moderné prístupy genómového sekvenovania a bioinformatiky odhalili množstvo príkladov sekvencií DNA odvodených z genómov DNA a RNA vírusov integrovaných do genómov stavovcov aj hmyzu. Retrovírusy kódujú RNA-dependentné DNA polymerázy (reverzné transkriptázy) a integrázy, ktoré konvertujú ich RNA vírusové genómy na DNA provírusy a uľahčujú integráciu provírusovej DNA do hostiteľského genómu. Prekvapivo sa v hostiteľských genómoch vyskytujú aj sekvencie DNA odvodené z RNA vírusov, ktoré nekódujú tieto enzýmy. Neretrovírusové integrované sekvencie RNA vírusu (NIRVS) sa vyskytujú s relatívne vysokou frekvenciou v genómoch arbovírusových vektorov Aedes aegypti a Aedes albopictus, nie sú distribuované náhodne a možno prispievajú k antivírusovej imunite proti komárom, čo naznačuje, že tieto komáre by mohli slúžiť ako modelový systém na odhalenie funkcie NIRVS. Tu sa zaoberáme nasledujúcimi otázkami: Čo poháňa syntézu DNA z genómov neretrovírusových RNA vírusov? Ako prebieha integrácia vírusovej cDNA do hostiteľskej DNA a aká je jej biologická funkcia (ak existuje)? Zhodnocujeme súčasné poznatky o vírusových integráciách v genómoch hmyzu, predpokladáme mechanizmy tvorby NIRVS a ich potenciálny vplyv na biológiu hmyzu, najmä antivírusovú imunitu, a navrhujeme smerovanie budúceho výskumu.


Retrovírusy "takmer pol miliardy rokov staré"

Retrovírus má membránu obsahujúcu glykoproteíny, ktoré sú schopné viazať sa na receptorový proteín na hostiteľskej bunke. V bunke sú dve vlákna RNA, ktoré majú tri enzýmy: proteázu, reverznú transkriptázu a integrázu (1). Prvým krokom replikácie je väzba glykoproteínu na receptorový proteín (2). Akonáhle sú tieto naviazané, bunková membrána degraduje, stáva sa súčasťou hostiteľskej bunky a vlákna RNA a enzýmy vstupujú do bunky (3). V bunke reverzná transkriptáza vytvára komplementárny reťazec DNA z retrovírusovej RNA a RNA je degradovaná, tento reťazec DNA je známy ako cDNA (4). cDNA sa potom replikuje a tieto dve vlákna vytvoria slabú väzbu a vstúpia do jadra (5). Akonáhle je DNA v jadre, je integrovaná do DNA hostiteľskej bunky pomocou integrázy (6). Táto bunka môže buď zostať nečinná, alebo môže byť RNA syntetizovaná z DNA a použitá na vytvorenie proteínov pre nový retrovírus (7). Ribozómové jednotky sa používajú na transkripciu mRNA vírusu do aminokyselinových sekvencií, ktoré môžu byť premenené na proteíny v hrubom endoplazmatickom retikule. Tento krok tiež vytvorí vírusové enzýmy a kapsidové proteíny (8). Vírusová RNA sa vytvorí v jadre. Tieto kúsky sa potom zhromaždia a oddelia sa od bunkovej membrány ako nový retrovírus (9). Kredit: Wikipedia/CC BY-SA 3.0

Retrovírusy – rodina vírusov, do ktorej patrí aj HIV – sú podľa nového výskumu vedcov z Oxfordskej univerzity staré takmer pol miliardy rokov. To je o niekoľko stoviek miliónov rokov staršie, než sa pôvodne predpokladalo, a naznačuje to, že retrovírusy majú staroveký morský pôvod, pretože boli so svojimi živočíšnymi hostiteľmi počas evolučného prechodu z mora na pevninu.

Zistenia sú uvedené v časopise Prírodné komunikácie, nám pomôže pochopiť viac o pokračujúcich „pretekoch v zbrojení“ medzi vírusmi a ich hostiteľmi.

Autor štúdie Dr Aris Katzourakis z Katedry zoológie Oxfordskej univerzity povedal: "O starovekom pôvode retrovírusov sa vie veľmi málo, čiastočne kvôli absencii geologických fosílnych záznamov. Retrovírusy sú široko rozšírené medzi stavovcami a môžu sa prenášať aj medzi hostiteľmi." , čo vedie k novým chorobám, ako je HIV, a ukázalo sa, že sú schopné preskakovať medzi vzdialenými príbuznými hostiteľmi, ako sú vtáky a cicavce. Doteraz sa však predpokladalo, že retrovírusy sú relatívne nováčikovia – možno až pred 100 miliónmi rokov. Vek.

"Náš nový výskum ukazuje, že retrovírusy sú minimálne 450 miliónov rokov staré, ak nie staršie, a že museli pochádzať spolu s hostiteľmi zo stavovcov, ak nie skôr, v ranej paleozoickej ére. Okrem toho by boli prítomné v našej predkovia stavovcov pred kolonizáciou pevniny a sprevádzali svojich hostiteľov počas tohto prechodu z mora na pevninu, až do súčasnosti."

Retrovírusy sú rodinou vírusov, ktorá zahŕňa vírus HIV zodpovedný za pandémiu AIDS. Môžu tiež spôsobiť rakovinu a imunodeficiencie u mnohých zvierat. „Retro“ časť ich názvu pochádza zo skutočnosti, že sú vyrobené z RNA, ktorú dokážu premeniť na DNA a vložiť do svojho hostiteľského genómu – opačným smerom ako je normálny tok informácií v bunke. Táto vlastnosť znamená, že môžu byť príležitostne zdedené ako endogénne retrovírusy (retrovírusy s vnútorným pôvodom), ktoré tvoria virtuálny genómový fosílny záznam, ktorý možno použiť na nahliadnutie do ich evolučnej histórie.

Tento výskum použil genómové sekvencie z endogénnych retrovírusov, ktoré sa podobajú „penovým“ vírusom – skupine vírusov, ktoré majú tendenciu sa rozchádzať so svojimi hostiteľmi. Penové vírusy sú rozšírené u cicavcov a v tejto štúdii výskumníci objavili genómové fosílie pre penovité retrovírusy vo veľmi rôznorodých hostiteľoch, vrátane lúčoplutvých rýb a obojživelníkov, u ktorých sa predtým nenašli.

Počas tejto štúdie vedci prekonali jedno z kľúčových obmedzení pri štúdiu hlbokej evolučnej histórie vírusov: ich rýchly vývoj. Táto vlastnosť uľahčuje rekonštrukciu nedávnej histórie vírusov, ale zakrýva ich vzdialenejšiu minulosť. Nový model použitý v tomto výskume - v kombinácii s genomickými fosílnymi záznamami penovitých vírusov - však umožnil vedcom vysvetliť zjavné spomalenie evolúcie, čím ďalej dozadu.

Dr Katzourakis dodal: "Tieto zistenia ukazujú, že táto medicínsky dôležitá skupina vírusov je stará najmenej pol miliardy rokov - oveľa staršia, ako sa doteraz predpokladalo. Pochádzajú z počiatku stavovcov, a to nám dáva kontext, v ktorom mali by sme zvážiť ich súčasnú aktivitu a interakcie s ich hostiteľmi. Napríklad adaptácie, ktoré si stavovce vyvinuli na boj proti vírusom, a zodpovedajúce protivírusové protiopatrenia, sú výsledkom nepretržitých pretekov v zbrojení, ktoré siahajú stovky milióny rokov.

"Náš odvodený dátum vzniku retrovírusov sa zhoduje s pôvodom adaptívnej imunity, a preto je pravdepodobné, že retrovírusy zohrali dôležitú úlohu pri vzniku tohto kľúčového nástroja v antivírusovej obrane stavovcov. Keďže chápeme povahu interakcie medzi vírusov a hostiteľskej imunity, budeme mať lepšiu pozíciu na to, aby sme zasiahli do týchto jemne vyvážených pretekov v zbrojení, aby sme vyvinuli nové liečby a intervencie.

"A keď vytvárame jasnejší obraz o pôvode rôznych skupín vírusov, ktoré nás dnes infikujú, mali by sme sa priblížiť k odhaleniu tajomstva ich konečného pôvodu."


Komponenty použité v RT-qPCR:

Výber komponentov pre reverznú transkripčnú PCR je rovnako dôležitý ako výber teplotných podmienok, ale nebojte sa, súprava pre reverznú transkripciu PCR pripravená na použitie obsahuje všetky zložky do reakčného pufra a reakčnej zmesi.

Výber každej zložky PCR a jej množstva je rovnako dôležitý ako výber teplotných podmienok pre PCR. V súčasnosti sú pripravené na použitie súpravy PCR na reverznú transkripciu, ktoré zefektívnia vašu prácu, pretože obsahujú všetky zložky. Pozrime sa na niektoré komponenty RT-PCR,

  • Enzým reverznej transkriptázy s aktivitou RNázy
  • RNáza H (ak ju reverzná transkriptáza nemá)
  • DNA polymeráza

Abstraktné

Mnohé vírusy nesú do viriónovej častice viac ako jeden segment nukleovej kyseliny, ale retrovírusy sú jedinou známou skupinou vírusov, ktoré obsahujú dve identické (alebo takmer identické) kópie RNA genómu vo virióne. Tieto RNA genómy sú nekovalentne spojené prostredníctvom procesu známeho ako genómová RNA dimerizácia. Jedinečne, RNA dimerizácia retrovírusového genómu má kľúčový význam pre účinnú retrovírusovú replikáciu. V tomto článku sa skúma naše súčasné chápanie vzťahu medzi konformáciou retrovírusového genómu, dimerizáciou a replikáciou.


Krok 7: Analýza údajov

A. Normalizácia údajov—Porovnávací Cq metóda

Dôležitosť normalizácie údajov qPCR bola opakovane zdôrazňovaná [1, 26]. Normalizácia údajov je kritickým krokom v pracovnom toku qPCR, pretože koriguje variácie vo viacerých krokoch vrátane purifikácie RNA, hodnotenia koncentrácie RNA, ako aj účinnosti reverznej transkripcie a amplifikácie. Normalizácia so stabilne exprimovanými referenčnými génmi ako vnútornými kontrolami, známymi ako porovnávací Cq alebo Δ㥌q je najbežnejšou metódou na normalizáciu údajov mRNA. Táto technika však vyžaduje príslušnú validáciu, aby sa zabezpečilo jej správne vykonanie [27]. Pre porovnávaciu Cq Aby bola metóda platná, je dôležité uistiť sa, že referenčné gény a cieľové gény majú podobnú účinnosť amplifikácie, ako platný porovnávací Cq metóda je založená na dodatočnom predpoklade podobnej účinnosti zosilnenia [28]. Pre 㥌 je možné vykresliť štandardnú krivkuq (rozdiel medzi referenčným a cieľovým génom oproti logaritmu vstupu cDNA) a absolútna hodnota smernice by mala byť π,1 [29]. Pozrite si príklad 㥌q medzi cyklofilín a PGC-1α na Obr. Ak nie je možné získať referenčné gény s podobnou účinnosťou amplifikácie ako cieľové, odporúča sa použiť na výpočet metódu Pfaffl, v ktorej je výpočet upravený o rozdiely v účinnosti amplifikácie cieľových a referenčných génov [30, 31].

Porovnávací Cq metóda normalizuje Cq hodnoty cieľového génu k interným referenčným génom pred vykonaním porovnaní medzi vzorkami. Po prvé, rozdiel medzi Cq hodnoty (㥌q) cieľového génu a geometrický priemer viacerých referenčných génov sa vypočíta pre každú vzorku a potom sa vypočíta rozdiel v 㥌q (Δ㥌q) sa vypočíta medzi dvoma vzorkami (napr. kontrola a ošetrenie alebo pred a po ošetrení). Násobná zmena v expresii dvoch vzoriek sa vypočíta ako 2 -Δ㥌q, kde 2 je odvodené od účinnosti 1 + a účinnosť sa predpokladá ako 1 (t. j. 100 % účinnosť) [28]. Naše odporúčanie na použitie porovnávacieho Cq metóda je uvedená v rámčeku 9.

Box 9

Je dôležité zabezpečiť, aby referenčné gény a cieľové gény mali podobnú účinnosť amplifikácie pri použití komparatívneho Cq inak by sa mala zvážiť Pfafflova metóda.

B. Výber referenčných génov

V analýze qPCR sa široko používa niekoľko tradičných referenčných génov. V prehľadovom článku sa uvádza, že 33 % a 32 % analýzy expresie zo 6 časopisov s veľkým vplyvom glyceraldehyd-3-fosfátdehydrogenáza (GAPDH) a aktín beta (ACTB) ako referenčné gény pre články publikované v roku 1999 [32]. Tá istá recenzia však poukázala na to, že výraz oboch GAPDH a ACTB sa značne líši v rôznych experimentálnych podmienkach v rôznych tkanivách [32]. GAPDH bol pôvodne identifikovaný ako medziprodukt v dráhe glykolýzy a očakávalo sa, že bude stabilne prítomný vo všetkých bunkách, preto bol vybraný ako referenčný gén. Avšak ďalšie aktivity o GAPDH, vrátane funkcií v endocytóze, translačnej kontrole a replikácii DNA [33], boli rozpoznané až neskôr [32].

V rôznych štúdiách cvičenia boli použité rôzne referenčné gény. Mahoney a kol. Informoval o tom -[34] β-2-mikroglobulín (B2M) a ACTB boli najstabilnejšie referenčné gény po 300 excentrických kontrakciách, zatiaľ čo B2M a GAPDH boli najstabilnejšie po 75 minútach vysoko intenzívneho prerušovaného cyklovania. V inej štúdii boli svalové biopsie odobraté pred, bezprostredne po a 4 hodiny po 30 minútach behu na bežiacom páse pri 70 % VO2 maxa RNA sa extrahovala zo 40 jednotlivých vlákien. GAPDH zistilo sa, že je stabilne exprimovaný vo všetkých vzorkách [35]. Preto pri použití referenčných génov ako interných kontrol pre cvičebnú štúdiu je potrebné starostlivo vyhodnotiť stabilitu každého referenčného génu a neexistuje gén ‘univerzálnej veľkosti, ktorý by sa dal použiť vo všetkých štúdiách a so všetkými cvičebnými protokolmi.

Aby sa znížila variabilita vnútornej kontroly, odporúča sa na normalizáciu použiť viacero génov [36, 37]. Pomocou vzoriek získaných z neuroblastómových bunkových línií Vandesompele a jeho kolegovia ukázali, že normalizácia s použitím jediného referenčného génu viedla k rozdielom 3,0-násobku v 25 % a 6,4-násobku v 10 % analyzovaných prípadov [36]. Vyhodnotenie referenčných génov možno dosiahnuť spustením štatistickej analýzy na Cq hodnotu alebo pomocou dostupného softvéru. Na hodnotenie referenčných génov je dostupných niekoľko softvérových programov s použitím rôznych analytických prístupov, ako napríklad BestKeeper [38], NormFinder [39] a GeNorm [36].

V našom laboratóriu máme šesť bežne používaných referenčných génov, ACTB, TATA-box viažuci proteín (TBP), cyklofilín, GAPDH, B2M, a 18S rRNA (Tabuľka 4). Existuje niekoľko dôvodov, prečo boli vybrané tieto kandidátske referenčné gény. Po prvé, týchto šesť génov sú potenciálne stabilne exprimované referenčné gény a sú široko používané v qPCR analýze vzoriek kostrového svalstva získaných v štúdiách ľudského cvičenia [34, 35, 40]. Po druhé, patria do rôznych funkčných tried, takže je nepravdepodobné, že sú koregulované. Avšak pomocou porovnávacieho Cq metódou, je ťažké kvalifikovať malé rozdiely v génovej expresii (t.j. menej ako 2-násobné), pokiaľ sa na normalizáciu nepoužije viacero stabilne exprimovaných referenčných génov [36, 41].

Tabuľka 4

GenePrírastok č.Funkcia (databáza referenčných sekvencií NCBI [42])
ACTB (aktín beta) <"type":"entrez-nukleotid","attrs":<"text":"NM_001101.3","term_id":"168480144","term_text":"NM_001101.3">> NM_001101.3Tento gén kóduje jeden zo šiestich rôznych aktínových proteínov, ktorý je hlavnou zložkou kontraktilného aparátu a jedným z dvoch nesvalových cytoskeletálnych aktínov.
TBP (TATA-box viažuci proteín) <"type":"entrez-nukleotid","attrs":<"text":"NM_003194.4","term_id":"285026518","term_text":"NM_003194.4">> NM_003194.4Tento gén kóduje všeobecný transkripčný faktor, ktorý sa špecificky viaže na sekvenciu DNA nazývanú TATA box a pomáha umiestniť RNA polymerázu II nad miesto začiatku transkripcie génu.
Cyklofilín (PPIA, peptidyl-prolyl cis-trans izomeráza A) <"type":"entrez-nukleotid","attrs":<"text":"NM_021130.4","term_id":"665821272","term_text":"NM_021130.4">> NM_021130.4Tento gén kóduje proteín, ktorý katalyzuje cis-trans izomerizáciu prolín imidových peptidových väzieb v oligopeptidoch a urýchľuje skladanie proteínov.
GAPDH (glyceraldehyd-3-fosfát dehydrogenáza) <"type":"entrez-nukleotid","attrs":<"text":"NM_001289746.1","term_id":"576583523","term_text":"NM_001289746.1">> NM_001289746.1Tento gén kóduje kľúčový enzým v glykolytickej dráhe, ktorý katalyzuje reverzibilnú oxidačnú fosforyláciu glyceraldehyd-3-fosfátu v prítomnosti anorganického fosfátu a nikotínamid adenín dinukleotidu (NAD).
B2M (β-2-mikroglobulín) <"type":"entrez-nukleotid","attrs":<"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2">> NM_004048.2Tento gén kóduje sérový proteín v spojení s ťažkým reťazcom hlavného histokompatibilného komplexu (MHC) triedy I na povrchu takmer všetkých jadrových buniek.
18S rRNA (RNA, 18S ribozomálne) <"type":"entrez-nukleotid","attrs":<"text":"NR_003286.2","term_id":"225637497","term_text":"NR_003286.2">> NR_003286.2Tento gén predstavuje časť jednej repetície rDNA, ktorá kóduje 18S rRNA.

Experiment 4

V našej štúdii o ľudskom cvičení (pozri Materiály a metódy) boli odobraté vzorky svalov od 9 účastníkov v pokoji (základná línia) a potom ihneď po (0 h) a 3 h po (3 h) záverečnom 4-týždňovom tréningu. tréningový zásah. Všetky vzorky svalov boli okamžite zmrazené ihneď po svalovej biopsii a RNA pre všetky vzorky (n = 27) bola extrahovaná pomocou RNeasy Plus Universal Mini Kit s upraveným protokolom (s použitím 2-propanolu) pre všetky vzorky, ktoré sme získali. A260/A280 pomer väčší ako 1,9 a skóre RQI vyššie ako 7 (s použitím systému automatizovanej elektroforézy Experion). Potom sme vykonali reverznú transkripciu, aby sme premenili RNA na cDNA v jednom cykle, pred vykonaním analýzy qPCR. Aby sme našli stabilne exprimované referenčné gény vo všetkých vzorkách vo všetkých časových bodoch, testovali sme šesť referenčných génov (ACTB, TBP, cyklofilín, GAPDH, B2M, a 18S rRNA tabuľka 5 a obr. 7). Potom sme použili RefFinder na vyhodnotenie stability týchto génov. RefFinder je webový nástroj, ktorý dokáže súčasne spúšťať štyri dobre zavedené algoritmy (GeNorm [36], BestKeeper [38], NormFinder [39] a porovnávacie delta-CT [43]), pričom každému priraďuje vhodnú váhu. jednotlivé gény a vypočítajú geometrický priemer ich váh pre celkové konečné poradie [44]. Na základe odporúčaného komplexného hodnotenia od spoločnosti RefFlinder boli naše kandidátske gény zoradené od najviac po najmenej stabilné B2M, TBP, 18S rRNA, ACTB, GAPDH a cyklofilín (Tabuľka 5).

Cq hodnoty jednotlivých reakcií pomocou ACTB, TBP, cyklofilín, GAPDH, B2M, a 18S rRNA sú prezentované priméry. Všetky vzorky pochádzajú z cvičebnej štúdie (n = 9 účastníkov × 3 časové body = 27 vzoriek).

Tabuľka 5

Poradie v poradí (najviac stabilné)
Metóda123456
Delta CTTBPB2M18S rRNAACTBGAPDHcyklofilín
Best KeeperB2MTBP18S rRNAACTBGAPDHcyklofilín
NormFinderTBPB2M18S rRNAACTBGAPDHcyklofilín
GenormB2M/18S rRNATBPACTBGAPDHcyklofilín
Odporúčané komplexné hodnotenieB2MTBP18S rRNAACTBGAPDHcyklofilín

Aby sme ilustrovali, ako by sa dalo postupovať pri výbere referenčných génov, vyberáme PPARG koaktivátor 1 alfa (PGC-1α) ako príklad analýzy génovej expresie. PGC-1α je transkripčný koaktivátor, ktorý je obohatený o kostrové svalstvo. Ukázalo sa, že cvičenie je schopné zvýšiť PGC-1α obsah mRNA u ľudí [45]. Účinnosť amplifikácie všetkých šiestich kandidátskych referenčných génov bola podobná nášmu cieľovému génu, PGC-1α (Tabuľka 6). Použili sme geometrický priemer troch najlepších hodnotených génov podľa RefFinder (TBP, B2M, a 18S rRNA) na následnú normalizáciu údajov. Naše odporúčania pre výber referenčných génov sú uvedené v rámčeku 10.

Tabuľka 6

GenePrírastok č.Priméry (vpred a vzad)Veľkosť amplikónu (bp)Počiatočná pozícia (bp)Účinnosť (%)Zdroj
TBP (TATA-box viažuci proteín) <"type":"entrez-nukleotid","attrs":<"text":"NM_003194.4","term_id":"285026518","term_text":"NM_003194.4">> NM_003194.4 F: CAGTGACCCAGCAGCATCACT
R: AGGCCAAGCCCTGAGCGTAA
20512199[46]
Cyklofilín (PPIA, peptidyl-prolyl cis-trans izomeráza A) <"type":"entrez-nukleotid","attrs":<"text":"NM_021130.4","term_id":"665821272","term_text":"NM_021130.4">> NM_021130.4 F: GTCAACCCCACCGTGTTCTTC
R: TTTCTGCTGTCTTTGGGACCTTG
10093100[47]
B2M (β-2-mikroglobulín) <"type":"entrez-nukleotid","attrs":<"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2">> NM_004048.2 F: TGCTGTCTCCATGTTTGATGTATCT
R: TCTCTGCTCCCCCACCTCTAAGT
8658998[36]
ACTB (aktín beta) <"type":"entrez-nukleotid","attrs":<"text":"NM_001101.3","term_id":"168480144","term_text":"NM_001101.3">> NM_001101.3 F: GAGCACAGAGCCTCGCCTTT
R: TCATCATCCATGGTGAGCTGGC
7026107Navrhnuté autormi
18S rRNA (RNA, 18S ribozomálne 5) <"type":"entrez-nukleotid","attrs":<"text":"NR_003286.2","term_id":"225637497","term_text":"NR_003286.2">> NR_003286.2 F: CTTAGAGGGACAAGTGGCG
R: GGACATCTAAGGGCATCACA
71144399[48]
GAPDH (glyceraldehyd-3-fosfát dehydrogenáza) <"type":"entrez-nukleotid","attrs":<"text":"NM_001289746.1","term_id":"576583523","term_text":"NM_001289746.1">> NM_001289746.1 F: AATCCCATCACCATCTTCCA
R: TGGACTCCACGACGTACTCA
82388106[49]
PGC-1α (koaktivátor PPARG 1 alfa) <"type":"entrez-nukleotid","attrs":<"text":"NM_013261.3","term_id":"116284374","term_text":"NM_013261.3">> NM_013261.3 F: CAGCCTCTTTGCCCAGATCTT
R: TCACTGCACCACTTGAGTCCAC
101199104[50]

Box 10

Odporúča sa testovať viacero referenčných génov [36, 37] a pred výberom vhodných referenčných génov pre konkrétnu štúdiu by sa mala posúdiť stabilita každého génu. Na posúdenie stability referenčných génov odporúčame použiť RefFinder, pretože súčasne beží štyri dobre zavedené algoritmy. Okrem stability referenčného génu by mala byť účinnosť amplifikácie referenčných génov podobná cieľovým génom.

C. Normalizácia génovej expresie prostredníctvom kvantifikácie cDNA

Nájdenie stabilných referenčných génov je výzvou pri vykonávaní qPCR a výskumníci hľadali alternatívne metódy, ako je kvantifikácia cDNA. Činidlo Quant-iT ™ OliGreen ssDNA je fluorescenčné farbivo nukleovej kyseliny na kvantifikáciu cDNA a používa sa v mnohých publikovaných prácach vrátane štúdií skúmajúcich génovú expresiu v ľudskom kostrovom svale v reakcii na cvičenie [51�]. Potenciálnym problémom pri použití farbiva OliGreen na kvantifikáciu obsahu cDNA je, že farbivo je citlivé aj na RNA, ako je uvedené v používateľskej príručke “činidlo OliGreen vykazuje zvýšenie fluorescencie, keď je naviazané na RNA” [54].

Experiment 5

Aby sme otestovali špecifickosť a platnosť použitia farbiva OliGreen na určenie obsahu cDNA, syntetizovali sme cDNA zo štyroch rôznych množstiev (0, 0,25, 0,5 a 1 μg) RNA získanej z Experimentu 1 (‘Správna prax”, n = 4 pre každý vstup RNA). Do kontrolnej reakcie–RT sme tiež naniesli 1 μg RNA, ktorá neobsahovala žiadnu cDNA (n = 4). Na syntézu cDNA sme použili iScript ™ reverzný transkripčný supermix (Bio-Rad). Enzým reverzná transkriptáza v tejto súprave má aktivitu RNázy H+, ktorá degraduje vlákno RNA v hybridoch RNA-DNA po syntéze cDNA. Obsah cDNA v každej vzorke sa potom meral s použitím farbiva OliGreen (obr. 8A). V súlade s predchádzajúcim výskumom [51] vzorky cDNA syntetizované z rôznych množstiev RNA vykazovali silnú pozitívnu koreláciu medzi nameranou koncentráciou cDNA oproti vstupu RNA (r = 0,9947, P< 0,0001) (obr. 8B). Avšak kontrolná reakcia -RT, ktorá obsahovala iba 1 μg RNA, ale žiadnu cDNA, vykazovala vyššiu hodnotu ako cDNA syntetizovaná z 0,5 μg RNA. Tento výsledok potvrdil, že farbivo OliGreen špecificky nemeria ssDNA, ale meria aj RNA. To by mohlo spôsobiť falošne vysoký obsah cDNA v teste, ak RNA nie je správne degradovaná. Naše odporúčania na normalizáciu génovej expresie prostredníctvom kvantifikácie cDNA sú uvedené v rámčeku 11.

A: Determination of cDNA amount in reactions with different RNA input. Different amounts of RNA were used to synthesise cDNA (n = 4 for each RNA input), and the relative amount of cDNA in each reaction was measured using OliGreen dye. Values are presented as mean ± SD. B: Correlation between RNA input and average relative amount of cDNA measured.

Box 11

In order to obtain an accurate and specific measurement of cDNA from the Oligreen dye, RNA in the RNA-DNA hybrids needs to be degraded before measurement. This can be achieved by using a reverse transcriptase enzyme with RNase H + activity ( Fig 8 ), or including an RNase degradation step after cDNA synthesis [51].

D. Effect of normalisation methods on the results

Experiment 6

To investigate how normalisation might alter the outcome, we measured the exercise-induced expression of PGC-1α mRNA in the samples from a human exercise study (as described in Experiment 4) and analysed the same set of data in three ways. We performed normalisation using three of the most stable reference genes (TBP, B2M, a 18S rRNA), based on the reference gene evaluation ( Table 5 ). In comparison, we also used a single reference gene, Cyclophilin, which was the lowest ranked reference gene. Lastly, we analysed the data using the cDNA content measured by Quant-iT ™ OliGreen ssDNA Reagent. We saw a significant difference in gene expression at 3 hours after exercise using all three normalisation options (P < 0.01, Fig 9 ). These exercise-induced fold changes in PGC-1α expression are consistent with the existing literature [40, 45].

Muscle samples were taken at rest (Baseline, Week 0) and immediately post-exercise (0 h), and 3 h post-exercise. Data were analysed using 3 different normalisation methods. Values are fold change ± SD.

There were no significant differences between the fold changes in PGC-1α mRNA content when using different methods of normalisation however, the fold changes were more similar when using three reference genes and cDNA content for normalisation, rather than using one reference gene. The increase of PGC-1α was 3.4 ± 2.0 fold when three reference genes were used for normalisation. When a single reference gene (Cyclophilin) was used for normalisation, the increase in gene expression was 5.1 ± 2.4 fold (P = 0.08 compared to 3 reference genes). When cDNA content was used for normalisation, the increase of gene expression was 3.2 ± 1.9 fold (P = 0.51 compared to 3 reference genes, P = 0.09 compared to 1 reference gene). In certain experimental settings, especially when examining small changes in mRNA level, these different results could lead to different conclusions. This may also help to explain the inter-study variability for exercise-induced changes in mRNA content. As previously suggested, use of a single reference gene is considered ‘not acceptable’ unless its stability has been clearly demonstrated in the same study [1]. Our recommendations for normalising gene expression via reference genes are listed in Box 12.

Box 12

We recommend testing four or more candidate reference genes for each study, and selecting the ones that are stably expressed for data normalisation. In our research laboratory, we chose to use two to three most stable reference genes based on evaluation software for an individual study [45, 55].


DNA provirus hypothesis

In the mid-20th century there were many advances in molecular biology, including the description of DNA in 1953 by American geneticist and biophysicist James D. Watson and British biophysicists Francis Crick and Maurice Wilkins. By the 1960s it was understood that sarcomas are caused by a mutation that results in uncontrolled cell division. It was also evident that RSV was inherited during the division of cancerous cells. This inheritance occurred in a manner agreeing with the Mendelian laws of genetic inheritance—laws that heretofore had been understood to apply only to DNA molecules (pozri the articles genetics and heredity).

Scientists hypothesized that, in order for such viral inheritance to occur, a virus would need to transcribe its RNA genome into DNA and then insert this DNA into the host cell genome. Once incorporated into the host genome, the virus would be transcribed as though it were another gene and could produce more RNA virus from its DNA. This hypothesis, called the “DNA provirus hypothesis,” was developed in the late 1950s by American virologist Howard Martin Temin, when he was a postdoctoral fellow in the laboratory of Italian virologist Renato Dulbecco at the California Institute of Technology. Temin’s hypothesis was formally proposed in 1964. The provirus hypothesis came about when experiments demonstrated that an antibiotic called actinomycin D, which is capable of inhibiting DNA and RNA synthesis, inhibited the reproduction of RSV. However, the concept of an RNA molecule’s turning itself into DNA drew very few supporters.